Transcript: Human NM_002471.3

Homo sapiens myosin heavy chain 6 (MYH6), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
MYH6 (4624)
Length:
5941
CDS:
72..5891

Additional Resources:

NCBI RefSeq record:
NM_002471.3
NBCI Gene record:
MYH6 (4624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437816 TCCTACGCAACTGCCGATACT pLKO_005 1941 CDS 100% 4.950 6.930 N MYH6 n/a
2 TRCN0000415516 AGGCAAGGTCATTGCTGAAAC pLKO_005 239 CDS 100% 10.800 7.560 N MYH6 n/a
3 TRCN0000083533 GCTCTCTTATACCCAGCAAAT pLKO.1 3992 CDS 100% 10.800 7.560 N MYH6 n/a
4 TRCN0000437130 GGAGGAAATCTCGGACCTTAC pLKO_005 4595 CDS 100% 6.000 4.200 N MYH6 n/a
5 TRCN0000220540 CGCATTGAGTTCAAGAAGATA pLKO.1 2469 CDS 100% 5.625 3.938 N Myh6 n/a
6 TRCN0000220539 GCGGAACAAGACAACCTCAAT pLKO.1 2754 CDS 100% 4.950 3.465 N Myh6 n/a
7 TRCN0000418089 GGACAATGCCAATGCGAACAA pLKO_005 692 CDS 100% 4.950 3.465 N MYH6 n/a
8 TRCN0000083537 AGCTGAGAGAAACTACCACAT pLKO.1 908 CDS 100% 4.050 2.835 N MYH6 n/a
9 TRCN0000083534 CCTGTCCAAGTCTAAGGTCAA pLKO.1 3134 CDS 100% 4.050 2.835 N MYH6 n/a
10 TRCN0000083535 GAGTTCAAGAAGATAGTGGAA pLKO.1 2475 CDS 100% 2.640 1.848 N MYH6 n/a
11 TRCN0000446189 CACCTGGGCAAGTCCAACAAT pLKO_005 1740 CDS 100% 5.625 3.375 N MYH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15503 pDONR223 0% 90.4% 92.6% None (many diffs) n/a
2 ccsbBroad304_15503 pLX_304 0% 90.4% 92.6% V5 (many diffs) n/a
3 TRCN0000466427 GTATGGACTATCGCGATATGCGCC pLX_317 6.9% 90.4% 92.6% V5 (many diffs) n/a
4 TRCN0000470090 CGCTCATCACTAGCCCGGCCCGTT pLX_317 6.9% 90.3% 92.4% V5 (many diffs) n/a
Download CSV