Transcript: Human NM_002535.3

Homo sapiens 2'-5'-oligoadenylate synthetase 2 (OAS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
OAS2 (4939)
Length:
4622
CDS:
91..2154

Additional Resources:

NCBI RefSeq record:
NM_002535.3
NBCI Gene record:
OAS2 (4939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429158 CCTACTGTAGCAACCTGAAAT pLKO_005 2208 3UTR 100% 13.200 18.480 N OAS2 n/a
2 TRCN0000414756 CATCTTCTGGAAGGTCAATTA pLKO_005 1908 CDS 100% 13.200 9.240 N OAS2 n/a
3 TRCN0000005018 CCCACCAAACTAAAGGATTTA pLKO.1 1696 CDS 100% 13.200 9.240 N OAS2 n/a
4 TRCN0000005020 CCAACGTGACATCCTCGATAA pLKO.1 369 CDS 100% 10.800 7.560 N OAS2 n/a
5 TRCN0000431526 TGGAGCTGCTTACGGTGTATG pLKO_005 764 CDS 100% 10.800 7.560 N OAS2 n/a
6 TRCN0000005019 CCGACAATCAACAGCCAAGAT pLKO.1 1236 CDS 100% 4.950 3.465 N OAS2 n/a
7 TRCN0000005017 CCACCCTCTTTAGCTGTTAAT pLKO.1 2480 3UTR 100% 13.200 7.920 N OAS2 n/a
8 TRCN0000412704 CCGTACTGGAGCTGATCAAAT pLKO_005 839 CDS 100% 13.200 7.920 N OAS2 n/a
9 TRCN0000005021 GCAGGGCTCATTGATCTGTAT pLKO.1 1600 CDS 100% 4.950 2.970 N OAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06664 pDONR223 100% 99.9% 100% None 753A>T n/a
2 ccsbBroad304_06664 pLX_304 0% 99.9% 100% V5 753A>T n/a
3 TRCN0000467853 CTGACCAAGCAAATGACCAGGCGT pLX_317 17.5% 99.9% 100% V5 753A>T n/a
Download CSV