Transcript: Human NM_002733.5

Homo sapiens protein kinase AMP-activated non-catalytic subunit gamma 1 (PRKAG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
PRKAG1 (5571)
Length:
1657
CDS:
37..1032

Additional Resources:

NCBI RefSeq record:
NM_002733.5
NBCI Gene record:
PRKAG1 (5571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002733.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195186 CCTAGATGTATCTGTGACTAA pLKO.1 807 CDS 100% 4.950 6.930 N PRKAG1 n/a
2 TRCN0000194831 CGTGTATACTTCCTTCATGAA pLKO.1 117 CDS 100% 4.950 6.930 N PRKAG1 n/a
3 TRCN0000003114 CCCAGAATCAGGCAATACTTT pLKO.1 507 CDS 100% 5.625 4.500 N PRKAG1 n/a
4 TRCN0000195237 CCATCACTGATTTCATCAATA pLKO.1 296 CDS 100% 13.200 9.240 N PRKAG1 n/a
5 TRCN0000195386 CTCTGGAAGAGCTACAGATTG pLKO.1 611 CDS 100% 10.800 7.560 N PRKAG1 n/a
6 TRCN0000197146 GCCAGTTATTGACCCAGAATC pLKO.1 495 CDS 100% 10.800 7.560 N PRKAG1 n/a
7 TRCN0000003115 CTACCCTTACCCTCACACATA pLKO.1 1211 3UTR 100% 4.950 3.465 N PRKAG1 n/a
8 TRCN0000003111 GCTTGTCTGCATTTCTCCTAA pLKO.1 420 CDS 100% 4.950 3.465 N PRKAG1 n/a
9 TRCN0000003112 GCTTTGGTGACTAACGGTGTA pLKO.1 223 CDS 100% 4.050 2.835 N PRKAG1 n/a
10 TRCN0000003113 CCCAGAATCCAACAATAGCGT pLKO.1 99 CDS 100% 0.750 0.525 N PRKAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002733.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01279 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01279 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469241 CGTTTCCAGAGTTCACATCTGGTT pLX_317 39.8% 100% 100% V5 n/a
4 ccsbBroadEn_14783 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14783 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000473792 TGATCGGGTGAATCCCGAGTAAAG pLX_317 51.5% 100% 100% V5 n/a
Download CSV