Transcript: Human NM_002793.4

Homo sapiens proteasome 20S subunit beta 1 (PSMB1), mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
PSMB1 (5689)
Length:
891
CDS:
66..791

Additional Resources:

NCBI RefSeq record:
NM_002793.4
NBCI Gene record:
PSMB1 (5689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002793.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003900 TGCTCTTATCACCAATCAGTT pLKO.1 798 3UTR 100% 4.950 6.930 N PSMB1 n/a
2 TRCN0000277846 TGCTCTTATCACCAATCAGTT pLKO_005 798 3UTR 100% 4.950 6.930 N PSMB1 n/a
3 TRCN0000003898 GAAGCAAGACTAAAGATGTAT pLKO.1 354 CDS 100% 5.625 3.938 N PSMB1 n/a
4 TRCN0000277907 GAAGCAAGACTAAAGATGTAT pLKO_005 354 CDS 100% 5.625 3.938 N PSMB1 n/a
5 TRCN0000003899 CGGATCTGCATAGTGACCAAA pLKO.1 729 CDS 100% 4.950 3.465 N PSMB1 n/a
6 TRCN0000277845 CGGATCTGCATAGTGACCAAA pLKO_005 729 CDS 100% 4.950 3.465 N PSMB1 n/a
7 TRCN0000003901 GCGGCTGGTGAAAGATGTCTT pLKO.1 665 CDS 100% 4.950 3.465 N PSMB1 n/a
8 TRCN0000003902 GCTTTGATCCAGTAGGGTCTT pLKO.1 517 CDS 100% 4.050 2.835 N PSMB1 n/a
9 TRCN0000277847 GCTTTGATCCAGTAGGGTCTT pLKO_005 517 CDS 100% 4.050 2.835 N PSMB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002793.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01309 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01309 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474053 AGTGAAAGAATCACCCCTATGAAC pLX_317 14.5% 100% 100% V5 n/a
4 ccsbBroadEn_06798 pDONR223 100% 99.8% 99.5% None 31C>G n/a
5 ccsbBroad304_06798 pLX_304 0% 99.8% 99.5% V5 31C>G n/a
6 TRCN0000470295 CCACAGGCCTCTAGATGTACTACA pLX_317 66.4% 99.8% 99.5% V5 31C>G n/a
Download CSV