Transcript: Human NM_002795.4

Homo sapiens proteasome 20S subunit beta 3 (PSMB3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-30
Taxon:
Homo sapiens (human)
Gene:
PSMB3 (5691)
Length:
762
CDS:
87..704

Additional Resources:

NCBI RefSeq record:
NM_002795.4
NBCI Gene record:
PSMB3 (5691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003910 GTCGGCAGATCAAACCTTATA pLKO.1 322 CDS 100% 13.200 18.480 N PSMB3 n/a
2 TRCN0000349489 GTCGGCAGATCAAACCTTATA pLKO_005 322 CDS 100% 13.200 18.480 N PSMB3 n/a
3 TRCN0000003911 CACCTGCGCCGAACAAATGTA pLKO.1 506 CDS 100% 5.625 7.875 N PSMB3 n/a
4 TRCN0000434782 CCAACCTCTTGTATGAGAAAC pLKO_005 361 CDS 100% 10.800 8.640 N PSMB3 n/a
5 TRCN0000368925 GTTGGACCCGAAGACCTTTAA pLKO_005 419 CDS 100% 13.200 9.240 N PSMB3 n/a
6 TRCN0000295142 CCATGGTGACTGATGACTTTG pLKO_005 475 CDS 100% 10.800 7.560 N Psmb3 n/a
7 TRCN0000295191 CGGACTTCCAGAAGATCTTTC pLKO_005 196 CDS 100% 10.800 7.560 N Psmb3 n/a
8 TRCN0000003908 GATCAAACCTTATACCCTCAT pLKO.1 329 CDS 100% 4.050 2.835 N PSMB3 n/a
9 TRCN0000010829 GTTGAAGGAAGGTCGGCAGAT pLKO.1 311 CDS 100% 4.050 2.835 N PSMB3 n/a
10 TRCN0000349552 GTTGAAGGAAGGTCGGCAGAT pLKO_005 311 CDS 100% 4.050 2.835 N PSMB3 n/a
11 TRCN0000003909 CTGTATGAGTTGAAGGAAGGT pLKO.1 303 CDS 100% 2.640 1.848 N PSMB3 n/a
12 TRCN0000318393 CTGTATGAGTTGAAGGAAGGT pLKO_005 303 CDS 100% 2.640 1.848 N PSMB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01311 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01311 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471203 CGCCACATCTCCACATATGGGTTT pLX_317 62.8% 100% 100% V5 n/a
Download CSV