Transcript: Human NM_002824.6

Homo sapiens parathymosin (PTMS), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PTMS (5763)
Length:
1162
CDS:
344..652

Additional Resources:

NCBI RefSeq record:
NM_002824.6
NBCI Gene record:
PTMS (5763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002824.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139323 CCAAACGGCAGAAGACAGAAA pLKO.1 615 CDS 100% 4.950 3.465 N PTMS n/a
2 TRCN0000122353 CCCAAACGGCAGAAGACAGAA pLKO.1 614 CDS 100% 4.950 3.465 N PTMS n/a
3 TRCN0000138962 CCGGAAAGAGCGAAAGAAAGA pLKO.1 430 CDS 100% 4.950 3.465 N PTMS n/a
4 TRCN0000140747 GAAGAAGAAACTGCCGAGGAT pLKO.1 488 CDS 100% 2.640 1.848 N PTMS n/a
5 TRCN0000144552 GAAGAAGAAGAGGATGATGAA pLKO.1 548 CDS 100% 4.950 2.970 N PTMS n/a
6 TRCN0000144651 GAAGAAGATGAGGAAGAAGAA pLKO.1 533 CDS 100% 4.950 2.970 N PTMS n/a
7 TRCN0000140355 GATGGAGAGGAGGAAGATGAA pLKO.1 506 CDS 100% 4.950 2.970 N PTMS n/a
8 TRCN0000140200 GCTGAGGAGGAAGAAGAAGAA pLKO.1 476 CDS 100% 4.950 2.970 N PTMS n/a
9 TRCN0000122740 CCTGAAGGAGAAGAAGGAGAA pLKO.1 391 CDS 100% 4.050 2.430 N PTMS n/a
10 TRCN0000139687 CAAGGACCTGAAGGAGAAGAA pLKO.1 385 CDS 100% 4.950 2.475 Y PTMS n/a
11 TRCN0000145217 GAAGAAGAAGAAGAGGATGAT pLKO.1 545 CDS 100% 4.950 2.475 Y PTMS n/a
12 TRCN0000144930 GAAGAAGAAGATGAGGAAGAA pLKO.1 530 CDS 100% 4.950 2.475 Y PTMS n/a
13 TRCN0000144578 GAAGATGAGGAAGAAGAAGAA pLKO.1 536 CDS 100% 4.950 2.475 Y PTMS n/a
14 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 394 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002824.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11072 pDONR223 100% 55.6% 24.2% None (many diffs) n/a
2 ccsbBroad304_11072 pLX_304 0% 55.6% 24.2% V5 (many diffs) n/a
3 TRCN0000465495 CAATGGGAACAACATCACCCATAG pLX_317 100% 55.6% 24.2% V5 (many diffs) n/a
Download CSV