Transcript: Human NM_002855.5

Homo sapiens nectin cell adhesion molecule 1 (NECTIN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NECTIN1 (5818)
Length:
5956
CDS:
648..2201

Additional Resources:

NCBI RefSeq record:
NM_002855.5
NBCI Gene record:
NECTIN1 (5818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002855.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379037 AGGCCAGGTGGAGGTCAATAT pLKO_005 1625 CDS 100% 13.200 18.480 N NECTIN1 n/a
2 TRCN0000373346 GCACCAAGAAGCACGTGTATG pLKO_005 1816 CDS 100% 10.800 8.640 N NECTIN1 n/a
3 TRCN0000373345 TACCACTGGACCACGCTAAAT pLKO_005 1485 CDS 100% 0.000 0.000 N NECTIN1 n/a
4 TRCN0000062934 CCAGAACAGAACCCTCTTCTT pLKO.1 1532 CDS 100% 4.950 3.465 N NECTIN1 n/a
5 TRCN0000062933 CGACTCCATGTATGGCTTCAT pLKO.1 755 CDS 100% 4.950 3.465 N NECTIN1 n/a
6 TRCN0000062935 CTCACTCTCAACGTGCAGTAT pLKO.1 1362 CDS 100% 4.950 3.465 N NECTIN1 n/a
7 TRCN0000062937 CCAGTGTGGTATCCTGGGAAA pLKO.1 1186 CDS 100% 4.050 2.835 N NECTIN1 n/a
8 TRCN0000109446 CGACGGGTCTTTCATTTCCAA pLKO.1 2162 CDS 100% 3.000 2.100 N Nectin1 n/a
9 TRCN0000062936 CGGCCCTACTTCACCGTGGAT pLKO.1 2043 CDS 100% 0.000 0.000 N NECTIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002855.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01349 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01349 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473295 GTGGCACATAAACTATTTCCTATC pLX_317 13.9% 100% 100% V5 n/a
Download CSV