Transcript: Human NM_002964.5

Homo sapiens S100 calcium binding protein A8 (S100A8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
S100A8 (6279)
Length:
408
CDS:
56..337

Additional Resources:

NCBI RefSeq record:
NM_002964.5
NBCI Gene record:
S100A8 (6279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002964.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053774 GTCTGGTTCAAAGAGTTGGAT pLKO.1 212 CDS 100% 3.000 4.200 N S100A8 n/a
2 TRCN0000053773 CCACAAGTACTCCCTGATAAA pLKO.1 103 CDS 100% 13.200 9.240 N S100A8 n/a
3 TRCN0000426401 GGAATTTCCATGCCGTCTACA pLKO_005 126 CDS 100% 4.950 3.465 N S100A8 n/a
4 TRCN0000053775 TCAACACTGATGGTGCAGTTA pLKO.1 234 CDS 100% 4.950 3.465 N S100A8 n/a
5 TRCN0000053776 GAACTCTATCATCGACGTCTA pLKO.1 82 CDS 100% 4.050 2.835 N S100A8 n/a
6 TRCN0000434787 AGAGTTGGATATCAACACTGA pLKO_005 223 CDS 100% 2.640 1.848 N S100A8 n/a
7 TRCN0000053777 GTGTCCTCAGTATATCAGGAA pLKO.1 178 CDS 100% 2.640 1.584 N S100A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002964.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01476 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01476 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472439 ACATTTAGGTCCGAAAGTATATTC pLX_317 100% 100% 100% V5 n/a
Download CSV