Transcript: Human NM_003027.5

Homo sapiens SH3 domain containing GRB2 like 3, endophilin A3 (SH3GL3), transcript variant EEN-B2-L1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SH3GL3 (6457)
Length:
1693
CDS:
194..1237

Additional Resources:

NCBI RefSeq record:
NM_003027.5
NBCI Gene record:
SH3GL3 (6457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003027.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154820 GCAAGCTACAGATGCGAATAT pLKO.1 906 CDS 100% 13.200 18.480 N SH3GL3 n/a
2 TRCN0000156068 CATACAGAGCTAAGCTAGGAA pLKO.1 381 CDS 100% 3.000 4.200 N SH3GL3 n/a
3 TRCN0000419527 GGTGAAAGACTCTCTTGATAT pLKO_005 571 CDS 100% 13.200 10.560 N SH3GL3 n/a
4 TRCN0000412950 ACTAAACTAGACGATGAATTT pLKO_005 272 CDS 100% 13.200 9.240 N SH3GL3 n/a
5 TRCN0000416034 ACAAACTCTGGACATACTTTC pLKO_005 1247 3UTR 100% 10.800 7.560 N SH3GL3 n/a
6 TRCN0000153860 CCACTTCAGTTACTACAAGAT pLKO.1 617 CDS 100% 4.950 3.465 N SH3GL3 n/a
7 TRCN0000155915 CCTATATTCCTCAGCTGCAAT pLKO.1 1533 3UTR 100% 4.950 3.465 N SH3GL3 n/a
8 TRCN0000155456 GAAGGAATGATACACGGAGAA pLKO.1 1163 CDS 100% 4.050 2.835 N SH3GL3 n/a
9 TRCN0000155365 CCACTGAATATCTTCAGCCAA pLKO.1 354 CDS 100% 0.264 0.185 N SH3GL3 n/a
10 TRCN0000158109 CGGTGTTCTGTGACATCCTTT pLKO.1 1305 3UTR 100% 4.950 2.970 N SH3GL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003027.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11130 pDONR223 100% 81.9% 80.8% None (many diffs) n/a
2 ccsbBroad304_11130 pLX_304 0% 81.9% 80.8% V5 (many diffs) n/a
3 TRCN0000470237 AACTTCTATATCTTTAAACCTCTC pLX_317 44.2% 81.9% 80.8% V5 (many diffs) n/a
Download CSV