Transcript: Human NM_003109.1

Homo sapiens Sp1 transcription factor (SP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SP1 (6667)
Length:
7614
CDS:
56..2392

Additional Resources:

NCBI RefSeq record:
NM_003109.1
NBCI Gene record:
SP1 (6667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285151 ACCTGGAGTGATGCCTAATAT pLKO_005 526 CDS 100% 15.000 10.500 N SP1 n/a
2 TRCN0000360587 AGCCATCATGCCTTGATAAAT pLKO_005 2737 3UTR 100% 15.000 10.500 N Sp1 n/a
3 TRCN0000020446 CCACTCCTTCAGCCCTTATTA pLKO.1 2247 CDS 100% 15.000 10.500 N SP1 n/a
4 TRCN0000226184 CACTCCTTCAGCCCTTATTAC pLKO_005 2248 CDS 100% 13.200 9.240 N Sp1 n/a
5 TRCN0000071605 GCAGGATGGTTCTGGTCAAAT pLKO.1 625 CDS 100% 13.200 9.240 N Sp1 n/a
6 TRCN0000274153 GGCAGATCTGCAGTCCATTAA pLKO_005 2350 CDS 100% 13.200 9.240 N SP1 n/a
7 TRCN0000020448 GCTGGTGGTGATGGAATACAT pLKO.1 1742 CDS 100% 5.625 3.938 N SP1 n/a
8 TRCN0000274208 GCTGGTGGTGATGGAATACAT pLKO_005 1742 CDS 100% 5.625 3.938 N SP1 n/a
9 TRCN0000020447 CCAGGTGCAAACCAACAGATT pLKO.1 656 CDS 100% 4.950 3.465 N SP1 n/a
10 TRCN0000071604 CCCAACTTACAGAACCAGCAA pLKO.1 491 CDS 100% 2.640 1.848 N Sp1 n/a
11 TRCN0000020445 GCAGCAACTTGCAGCAGAATT pLKO.1 227 CDS 100% 0.000 0.000 N SP1 n/a
12 TRCN0000285149 CTCCAAGGCCTGGCTAATAAT pLKO_005 746 CDS 100% 15.000 9.000 N SP1 n/a
13 TRCN0000020444 CCCAAGTTTATTTCTCTCTTA pLKO.1 7213 3UTR 100% 4.950 2.970 N SP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489380 AGAGTAATAAGTTCTAAGTCATCT pLX_317 8.5% 99.1% 99.1% V5 (not translated due to prior stop codon) 0_1ins21 n/a
Download CSV