Transcript: Human NM_003111.4

Homo sapiens Sp3 transcription factor (SP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
SP3 (6670)
Length:
6359
CDS:
532..2877

Additional Resources:

NCBI RefSeq record:
NM_003111.4
NBCI Gene record:
SP3 (6670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020490 CGCGAGATGATACTTTGATTA pLKO.1 2696 CDS 100% 13.200 18.480 N SP3 n/a
2 TRCN0000280368 CGCGAGATGATACTTTGATTA pLKO_005 2696 CDS 100% 13.200 18.480 N SP3 n/a
3 TRCN0000095549 GCTACCTTATTGTACGTTTAA pLKO.1 4215 3UTR 100% 13.200 18.480 N Sp3 n/a
4 TRCN0000020493 GTGGTGATTCTACCTTGAATA pLKO.1 2219 CDS 100% 13.200 10.560 N SP3 n/a
5 TRCN0000280370 GTGGTGATTCTACCTTGAATA pLKO_005 2219 CDS 100% 13.200 10.560 N SP3 n/a
6 TRCN0000020489 GCTGGTCTTGTAAGAGCTATA pLKO.1 4093 3UTR 100% 10.800 8.640 N SP3 n/a
7 TRCN0000280421 GCTGGTCTTGTAAGAGCTATA pLKO_005 4093 3UTR 100% 10.800 8.640 N SP3 n/a
8 TRCN0000020491 CCTTCTGCTAACATCCAGAAT pLKO.1 1189 CDS 100% 0.495 0.396 N SP3 n/a
9 TRCN0000280422 CCTTCTGCTAACATCCAGAAT pLKO_005 1189 CDS 100% 0.495 0.396 N SP3 n/a
10 TRCN0000271137 ACAATGACTGCAGGCATTAAT pLKO_005 1384 CDS 100% 15.000 10.500 N Sp3 n/a
11 TRCN0000280410 ACAATGACTGCAGGCATTAAT pLKO_005 1384 CDS 100% 15.000 10.500 N SP3 n/a
12 TRCN0000020492 GCCCAAATTGTGCAAGGTATT pLKO.1 1759 CDS 100% 10.800 7.560 N SP3 n/a
13 TRCN0000095551 CCTGGCTCTAATCAAACCTTA pLKO.1 1153 CDS 100% 4.950 3.465 N Sp3 n/a
14 TRCN0000095553 CCCAACTGTAAAGAAGGTGGT pLKO.1 2338 CDS 100% 2.160 1.512 N Sp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13959 pDONR223 99.8% 99.9% 99.7% None 2337delA n/a
2 ccsbBroad304_13959 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 2337delA n/a
3 ccsbBroadEn_13318 pDONR223 100% 15.1% 14.3% None (many diffs) n/a
4 ccsbBroad304_13318 pLX_304 0% 15.1% 14.3% V5 (many diffs) n/a
5 TRCN0000477706 TTATCAAAGCAATCCTGTGTTTAT pLX_317 100% 15.1% 14.3% V5 (many diffs) n/a
Download CSV