Transcript: Human NM_003297.4

Homo sapiens nuclear receptor subfamily 2 group C member 1 (NR2C1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
NR2C1 (7181)
Length:
4058
CDS:
247..2058

Additional Resources:

NCBI RefSeq record:
NM_003297.4
NBCI Gene record:
NR2C1 (7181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003297.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244442 GATGAATGTAGCAACTATATT pLKO_005 1578 CDS 100% 15.000 12.000 N NR2C1 n/a
2 TRCN0000244443 GCATTGATGGATACGAATATG pLKO_005 1724 CDS 100% 13.200 10.560 N NR2C1 n/a
3 TRCN0000021648 GCCAATGTGGTTACATCATTA pLKO.1 1063 CDS 100% 13.200 10.560 N NR2C1 n/a
4 TRCN0000021646 CCATTGAAGTATCACGAGAAA pLKO.1 812 CDS 100% 4.950 3.960 N NR2C1 n/a
5 TRCN0000244444 GCAGGTGTCAACCAGTTATTT pLKO_005 475 CDS 100% 15.000 10.500 N NR2C1 n/a
6 TRCN0000244441 AGGACCTTCGTAGCCCATTAA pLKO_005 878 CDS 100% 13.200 9.240 N NR2C1 n/a
7 TRCN0000021645 CGAGGATCAAAGGATTGTATT pLKO.1 694 CDS 100% 13.200 9.240 N NR2C1 n/a
8 TRCN0000244445 GAATTGTGTTCTAGTCATATT pLKO_005 2392 3UTR 100% 13.200 9.240 N NR2C1 n/a
9 TRCN0000021647 CCTGCAGATTATAACTCTCAA pLKO.1 2017 CDS 100% 4.950 3.465 N NR2C1 n/a
10 TRCN0000021644 GCCAGCTTTAAGACTGATGAA pLKO.1 1908 CDS 100% 4.950 3.465 N NR2C1 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 2875 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003297.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01709 pDONR223 100% 77.2% 76.9% None 1394_1405del;1410_1411delAAinsGG;1413_1809delinsG n/a
2 ccsbBroad304_01709 pLX_304 0% 77.2% 76.9% V5 1394_1405del;1410_1411delAAinsGG;1413_1809delinsG n/a
3 TRCN0000466565 GTAGGGGTTCACCGAAATCTACAC pLX_317 29.3% 77.2% 76.9% V5 1394_1405del;1410_1411delAAinsGG;1413_1809delinsG n/a
4 TRCN0000488735 TATACCCAAGGGAGTGTTTATAAA pLX_317 19% 77.2% 76.9% V5 (not translated due to prior stop codon) 1394_1405del;1410_1411delAAinsGG;1413_1809delinsG n/a
Download CSV