Transcript: Human NM_003299.3

Homo sapiens heat shock protein 90 beta family member 1 (HSP90B1), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
HSP90B1 (7184)
Length:
2782
CDS:
107..2518

Additional Resources:

NCBI RefSeq record:
NM_003299.3
NBCI Gene record:
HSP90B1 (7184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276247 CCATGATATGATGCCTAAATA pLKO_005 1372 CDS 100% 15.000 21.000 N HSP90B1 n/a
2 TRCN0000029425 CCTGTGGATGAATACTGTATT pLKO.1 1817 CDS 100% 13.200 9.240 N HSP90B1 n/a
3 TRCN0000276249 CCTGTGGATGAATACTGTATT pLKO_005 1817 CDS 100% 13.200 9.240 N HSP90B1 n/a
4 TRCN0000029426 CGTGGTCTGTTTGACGAATAT pLKO.1 1289 CDS 100% 13.200 9.240 N HSP90B1 n/a
5 TRCN0000285496 CGTGGTCTGTTTGACGAATAT pLKO_005 1289 CDS 100% 13.200 9.240 N HSP90B1 n/a
6 TRCN0000029424 GCGAGACTCTTCAGCAACATA pLKO.1 1449 CDS 100% 5.625 3.375 N HSP90B1 n/a
7 TRCN0000276248 GCGAGACTCTTCAGCAACATA pLKO_005 1449 CDS 100% 5.625 3.375 N HSP90B1 n/a
8 TRCN0000029427 GCTTTAGATAAGATAAGGCTA pLKO.1 437 CDS 100% 2.640 1.584 N HSP90B1 n/a
9 TRCN0000276250 ATCCTGTGTGGAGAGGGAATG pLKO_005 2539 3UTR 100% 6.000 3.000 Y HSP90B1 n/a
10 TRCN0000029428 CGACGAATTAAGGAAGATGAA pLKO.1 2201 CDS 100% 4.950 2.475 Y HSP90B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489328 AGTGAATAATCTACATCTGTAAAA pLX_317 14.6% 99.8% 99.8% V5 (not translated due to prior stop codon) 2277C>T;2362_2364delGAA n/a
2 ccsbBroadEn_13971 pDONR223 100% 39% 38.4% None (many diffs) n/a
3 ccsbBroad304_13971 pLX_304 0% 39% 38.4% V5 (many diffs) n/a
Download CSV