Transcript: Human NM_003309.4

Homo sapiens TSPY like 1 (TSPYL1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TSPYL1 (7259)
Length:
5073
CDS:
101..1414

Additional Resources:

NCBI RefSeq record:
NM_003309.4
NBCI Gene record:
TSPYL1 (7259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141937 GCAAAGAAGTTGGCCTGTAAA pLKO.1 2352 3UTR 100% 13.200 18.480 N TSPYL1 n/a
2 TRCN0000121676 GCAATGAGTATGCCTTCTATT pLKO.1 1485 3UTR 100% 13.200 18.480 N TSPYL1 n/a
3 TRCN0000344195 GCAATGAGTATGCCTTCTATT pLKO_005 1485 3UTR 100% 13.200 18.480 N TSPYL1 n/a
4 TRCN0000139838 CCGCCAGAAGGTGAAGAAATA pLKO.1 686 CDS 100% 13.200 9.240 N TSPYL1 n/a
5 TRCN0000344140 CCGCCAGAAGGTGAAGAAATA pLKO_005 686 CDS 100% 13.200 9.240 N TSPYL1 n/a
6 TRCN0000106393 CAAGCTGATTGTCAAGGAATA pLKO.1 1099 CDS 100% 10.800 7.560 N Tspyl1 n/a
7 TRCN0000308634 CAAGCTGATTGTCAAGGAATA pLKO_005 1099 CDS 100% 10.800 7.560 N Tspyl1 n/a
8 TRCN0000139997 GTGGCCAAATCCACTGCAATA pLKO.1 1300 CDS 100% 10.800 7.560 N TSPYL1 n/a
9 TRCN0000344141 GTGGCCAAATCCACTGCAATA pLKO_005 1300 CDS 100% 10.800 7.560 N TSPYL1 n/a
10 TRCN0000145080 GCAGAGATGTTAAGGTACATA pLKO.1 992 CDS 100% 5.625 3.938 N TSPYL1 n/a
11 TRCN0000106391 CCAGTCCTTCATTCGCAGAAA pLKO.1 1189 CDS 100% 4.950 3.465 N Tspyl1 n/a
12 TRCN0000140845 CCAGTCCTTCATTCGCAGAAA pLKO.1 1189 CDS 100% 4.950 3.465 N TSPYL1 n/a
13 TRCN0000308691 CCAGTCCTTCATTCGCAGAAA pLKO_005 1189 CDS 100% 4.950 3.465 N Tspyl1 n/a
14 TRCN0000122627 GCACCCTGTTTCCTTTGGATA pLKO.1 1531 3UTR 100% 4.950 3.465 N TSPYL1 n/a
15 TRCN0000344196 GCACCCTGTTTCCTTTGGATA pLKO_005 1531 3UTR 100% 4.950 3.465 N TSPYL1 n/a
16 TRCN0000139973 GCAGAAACCAAGACCTCATCT pLKO.1 1203 CDS 100% 4.950 3.465 N TSPYL1 n/a
17 TRCN0000142324 CAATACTACCTGTTGCGTGAA pLKO.1 1316 CDS 100% 4.050 2.835 N TSPYL1 n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4370 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4370 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11206 pDONR223 100% 99.7% 99.7% None 521_522insGGT n/a
2 ccsbBroad304_11206 pLX_304 0% 99.7% 99.7% V5 521_522insGGT n/a
3 TRCN0000479749 GCCCTCTAAAAATCTACTTCAGCC pLX_317 25% 99.7% 99.7% V5 521_522insGGT n/a
Download CSV