Transcript: Human NM_003366.4

Homo sapiens ubiquinol-cytochrome c reductase core protein 2 (UQCRC2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
UQCRC2 (7385)
Length:
1914
CDS:
64..1425

Additional Resources:

NCBI RefSeq record:
NM_003366.4
NBCI Gene record:
UQCRC2 (7385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046479 CGCAGACTCATGTCATTGAAA pLKO.1 569 CDS 100% 5.625 7.875 N UQCRC2 n/a
2 TRCN0000286328 CGCAGACTCATGTCATTGAAA pLKO_005 569 CDS 100% 5.625 7.875 N UQCRC2 n/a
3 TRCN0000046482 GCAAATTAAGTGTGACCGCAA pLKO.1 386 CDS 100% 2.160 3.024 N UQCRC2 n/a
4 TRCN0000293762 GTTATCAAGGCTGCCTATAAT pLKO_005 1111 CDS 100% 15.000 10.500 N UQCRC2 n/a
5 TRCN0000046478 GCCTTGGCTAATCCCTTGTAT pLKO.1 616 CDS 100% 5.625 3.938 N UQCRC2 n/a
6 TRCN0000286329 GCCTTGGCTAATCCCTTGTAT pLKO_005 616 CDS 100% 5.625 3.938 N UQCRC2 n/a
7 TRCN0000046481 GCCATTTGATGTTTCTGCATT pLKO.1 1020 CDS 100% 4.950 3.465 N UQCRC2 n/a
8 TRCN0000046480 GCAGATTGATTCAGTGGCTAA pLKO.1 1305 CDS 100% 4.050 2.835 N UQCRC2 n/a
9 TRCN0000286330 GCAGATTGATTCAGTGGCTAA pLKO_005 1305 CDS 100% 4.050 2.835 N UQCRC2 n/a
10 TRCN0000293761 TGATGCACACATTACAGGAGA pLKO_005 1429 3UTR 100% 2.640 1.848 N UQCRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01757 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01757 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470338 GTGCGCGTGGTAGTGGACAGCGAC pLX_317 34.9% 100% 100% V5 n/a
Download CSV