Transcript: Human NM_003487.4

Homo sapiens TATA-box binding protein associated factor 15 (TAF15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TAF15 (8148)
Length:
2153
CDS:
87..1856

Additional Resources:

NCBI RefSeq record:
NM_003487.4
NBCI Gene record:
TAF15 (8148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003487.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285485 TAATCCGTCATGCGGAAATAT pLKO_005 1160 CDS 100% 15.000 21.000 N TAF15 n/a
2 TRCN0000020142 CCAGTTATGGACAAAGTTATT pLKO.1 247 CDS 100% 13.200 17.160 N TAF15 n/a
3 TRCN0000020140 GCAGCAAAGTTATTCTACCTA pLKO.1 125 CDS 100% 3.000 2.400 N TAF15 n/a
4 TRCN0000285486 ATATAGCCAGCAACCATATAA pLKO_005 308 CDS 100% 15.000 10.500 N TAF15 n/a
5 TRCN0000276074 ATATGATGAGCAGTCAAATTA pLKO_005 461 CDS 100% 15.000 10.500 N TAF15 n/a
6 TRCN0000276145 TGACATGATCCATAGTGAAAT pLKO_005 1884 3UTR 100% 13.200 9.240 N TAF15 n/a
7 TRCN0000020141 CGTCGTGATGTGAGTAGGTAT pLKO.1 567 CDS 100% 4.950 3.465 N TAF15 n/a
8 TRCN0000020139 CCTATCATTCACAAAGGGAAA pLKO.1 520 CDS 100% 4.050 2.835 N TAF15 n/a
9 TRCN0000020143 GCTCGAAGGAATTCCTGCAAT pLKO.1 1188 CDS 100% 0.000 0.000 N TAF15 n/a
10 TRCN0000276144 GCTCGAAGGAATTCCTGCAAT pLKO_005 1188 CDS 100% 0.000 0.000 N TAF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003487.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07204 pDONR223 100% 99.4% 99.4% None 175_176insGTCAGTCAG;1515C>T n/a
2 ccsbBroad304_07204 pLX_304 0% 99.4% 99.4% V5 175_176insGTCAGTCAG;1515C>T n/a
3 TRCN0000477554 GACGTCATATTTTGGCCCCCAGCC pLX_317 1.1% 99.4% 99.4% V5 175_176insGTCAGTCAG;1515C>T n/a
Download CSV