Transcript: Human NM_003661.4

Homo sapiens apolipoprotein L1 (APOL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
APOL1 (8542)
Length:
2795
CDS:
107..1303

Additional Resources:

NCBI RefSeq record:
NM_003661.4
NBCI Gene record:
APOL1 (8542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118633 CGTGTACGAATCAAAGCACTT pLKO.1 1162 CDS 100% 4.050 5.670 N APOL1 n/a
2 TRCN0000377713 CTACTCCTGCTGACTGATAAT pLKO_005 359 CDS 100% 13.200 9.240 N APOL1 n/a
3 TRCN0000377712 GAACAGGTGGAGAGGGTTAAT pLKO_005 1052 CDS 100% 13.200 9.240 N APOL1 n/a
4 TRCN0000371337 GTGAGAACATATCCAACTTTC pLKO_005 882 CDS 100% 10.800 7.560 N APOL1 n/a
5 TRCN0000118636 TCTTTATTGAGGATGCCATTA pLKO.1 303 CDS 100% 10.800 7.560 N APOL1 n/a
6 TRCN0000118632 CCTCCGAAGAATGAAGTCTTT pLKO.1 2353 3UTR 100% 4.950 3.465 N APOL1 n/a
7 TRCN0000118634 GCCATTAAGTATTTCAAGGAA pLKO.1 317 CDS 100% 3.000 2.100 N APOL1 n/a
8 TRCN0000118635 CTGGAGGAGAAGCTAAACATT pLKO.1 1238 CDS 100% 5.625 3.375 N APOL1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1616 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1485 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1380 3UTR 100% 0.495 0.248 Y C11orf44 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1616 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07258 pDONR223 100% 99.5% 99.2% None (many diffs) n/a
2 ccsbBroad304_07258 pLX_304 0% 99.5% 99.2% V5 (many diffs) n/a
3 TRCN0000478358 TACCATCTGGAAGTTTTACAGCGA pLX_317 25.3% 99.5% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_15637 pDONR223 0% 59.7% 59.7% None 715_1194del n/a
Download CSV