Transcript: Human NM_003717.4

Homo sapiens neuropeptide FF-amide peptide precursor (NPFF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
NPFF (8620)
Length:
440
CDS:
11..352

Additional Resources:

NCBI RefSeq record:
NM_003717.4
NBCI Gene record:
NPFF (8620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003717.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244025 CTGGTGCTGCTGCTGTTAATA pLKO_005 38 CDS 100% 15.000 9.000 N NPFF n/a
2 TRCN0000244027 CCAGAGGTTTGGCAGAAATAC pLKO_005 229 CDS 100% 13.200 6.600 Y NPFF n/a
3 TRCN0000244029 GGGATCCTGGAGGAATGAATG pLKO_005 253 CDS 100% 10.800 5.400 Y NPFF n/a
4 TRCN0000244026 GAGCCAAGCCTTCCTGTTTCA pLKO_005 205 CDS 100% 4.950 2.475 Y NPFF n/a
5 TRCN0000244028 CTCTGGGTCACTGTTGCACTA pLKO_005 154 CDS 100% 4.050 2.025 Y NPFF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003717.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11287 pDONR223 100% 75.3% 65.3% None (many diffs) n/a
2 ccsbBroad304_11287 pLX_304 0% 75.3% 65.3% V5 (many diffs) n/a
3 TRCN0000471024 TACCCCATGATGCGGCAACCTTGT pLX_317 100% 75.3% 65.3% V5 (many diffs) n/a
Download CSV