Transcript: Human NM_003740.4

Homo sapiens potassium two pore domain channel subfamily K member 5 (KCNK5), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KCNK5 (8645)
Length:
3783
CDS:
365..1864

Additional Resources:

NCBI RefSeq record:
NM_003740.4
NBCI Gene record:
KCNK5 (8645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003740.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434137 GTATTACTGAGCTCGGCATTT pLKO_005 2256 3UTR 100% 10.800 15.120 N KCNK5 n/a
2 TRCN0000044915 CCAGACCTTCAACAACTGGAA pLKO.1 595 CDS 100% 2.640 2.112 N KCNK5 n/a
3 TRCN0000305516 ACTGGCCCAATGCAATGATTT pLKO_005 615 CDS 100% 13.200 9.240 N Kcnk5 n/a
4 TRCN0000440495 GGTGATCCCACCCTTCGTATT pLKO_005 889 CDS 100% 10.800 7.560 N KCNK5 n/a
5 TRCN0000044916 CCTTACGAACAGCTGATGAAT pLKO.1 1808 CDS 100% 5.625 3.938 N KCNK5 n/a
6 TRCN0000044917 GTCAACATCTTCAGCTTTCTT pLKO.1 1226 CDS 100% 5.625 3.938 N KCNK5 n/a
7 TRCN0000044913 CGTCATTACCACCATTGGATA pLKO.1 646 CDS 100% 4.950 3.465 N KCNK5 n/a
8 TRCN0000044914 GCTGATGAATGAGTACAACAA pLKO.1 1819 CDS 100% 4.950 3.465 N KCNK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003740.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01980 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01980 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477827 CTCACCGCCTCGTGATCGCTTCTG pLX_317 26% 100% 100% V5 n/a
Download CSV