Transcript: Human NM_003791.4

Homo sapiens membrane bound transcription factor peptidase, site 1 (MBTPS1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MBTPS1 (8720)
Length:
4377
CDS:
533..3691

Additional Resources:

NCBI RefSeq record:
NM_003791.4
NBCI Gene record:
MBTPS1 (8720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329842 CGCTATCCACCTGGCTATTTC pLKO_005 2426 CDS 100% 13.200 18.480 N MBTPS1 n/a
2 TRCN0000353575 GACGCTTGTTAAAGGCTATTT pLKO_005 4048 3UTR 100% 13.200 18.480 N MBTPS1 n/a
3 TRCN0000013269 GCGTCGTGATAACACAGACTT pLKO.1 2931 CDS 100% 4.950 6.930 N MBTPS1 n/a
4 TRCN0000329844 GAATAACCCTGCTGATCAAAT pLKO_005 1570 CDS 100% 13.200 9.240 N MBTPS1 n/a
5 TRCN0000329921 ACGCCTTCAACTATGCCATTT pLKO_005 1404 CDS 100% 10.800 7.560 N MBTPS1 n/a
6 TRCN0000013268 GCAGGTTTGTTAGAGTCTGTT pLKO.1 3800 3UTR 100% 4.950 3.465 N MBTPS1 n/a
7 TRCN0000013272 GCTAACAATGTAATCATGGTT pLKO.1 1511 CDS 100% 3.000 2.100 N MBTPS1 n/a
8 TRCN0000013270 CGACGTGTTAAACCTCAGCAT pLKO.1 1435 CDS 100% 2.640 1.848 N MBTPS1 n/a
9 TRCN0000329841 CGACGTGTTAAACCTCAGCAT pLKO_005 1435 CDS 100% 2.640 1.848 N MBTPS1 n/a
10 TRCN0000013271 CCTGACTTTGAAGGTGGAATT pLKO.1 652 CDS 100% 0.000 0.000 N MBTPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11298 pDONR223 100% 52.4% 52.3% None 856A>G;1317C>T;1657_3156del n/a
2 ccsbBroad304_11298 pLX_304 0% 52.4% 52.3% V5 856A>G;1317C>T;1657_3156del n/a
3 TRCN0000472973 CGGAGCCCGGCTTCAGTTCATCGG pLX_317 27.8% 52.4% 52.3% V5 856A>G;1317C>T;1657_3156del n/a
Download CSV