Transcript: Human NM_003931.3

Homo sapiens WASP family member 1 (WASF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-16
Taxon:
Homo sapiens (human)
Gene:
WASF1 (8936)
Length:
2886
CDS:
504..2183

Additional Resources:

NCBI RefSeq record:
NM_003931.3
NBCI Gene record:
WASF1 (8936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344771 AGAACGTGTGGACCGTTTATC pLKO_005 713 CDS 100% 13.200 18.480 N WASF1 n/a
2 TRCN0000122995 CGCCGTATTGCTGTTGAATAT pLKO.1 2112 CDS 100% 13.200 18.480 N WASF1 n/a
3 TRCN0000333515 CGCCGTATTGCTGTTGAATAT pLKO_005 2112 CDS 100% 13.200 18.480 N WASF1 n/a
4 TRCN0000122998 GCTAAGCATGAACGCATTGAA pLKO.1 2067 CDS 100% 5.625 7.875 N WASF1 n/a
5 TRCN0000363684 GCTAAGCATGAACGCATTGAA pLKO_005 2067 CDS 100% 5.625 7.875 N WASF1 n/a
6 TRCN0000379777 TGGAATGTGTAACCAATATTT pLKO_005 580 CDS 100% 15.000 10.500 N WASF1 n/a
7 TRCN0000379823 GAATTGTCTTTGCAAGATATA pLKO_005 768 CDS 100% 13.200 9.240 N WASF1 n/a
8 TRCN0000370117 TAAAGAAAGCAACTGAAATTG pLKO_005 2507 3UTR 100% 13.200 9.240 N WASF1 n/a
9 TRCN0000380829 TAATGGCCCAGCCTCTCATTT pLKO_005 1187 CDS 100% 13.200 9.240 N WASF1 n/a
10 TRCN0000122994 CCCACTTATATATTGTGTGAT pLKO.1 2739 3UTR 100% 4.950 3.465 N WASF1 n/a
11 TRCN0000122996 CCTTCGTATTTCTTTGATCTA pLKO.1 963 CDS 100% 4.950 3.465 N WASF1 n/a
12 TRCN0000122997 GCTGGCTGAAGATGATGCTAA pLKO.1 1139 CDS 100% 4.950 2.970 N WASF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02051 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02051 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473597 GCAGCGTCAATGTAGAGTAAAGAA pLX_317 19.9% 100% 100% V5 n/a
Download CSV