Transcript: Human NM_004041.5

Homo sapiens arrestin beta 1 (ARRB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ARRB1 (408)
Length:
7352
CDS:
55..1311

Additional Resources:

NCBI RefSeq record:
NM_004041.5
NBCI Gene record:
ARRB1 (408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004041.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230148 AGATCTCAGTGCGCCAGTATG pLKO_005 749 CDS 100% 10.800 15.120 N ARRB1 n/a
2 TRCN0000230150 GGTCCCAGGTGGTTAACAAAG pLKO_005 1715 3UTR 100% 10.800 15.120 N ARRB1 n/a
3 TRCN0000005160 CCTAGCCAATAACCGAGAGAA pLKO.1 885 CDS 100% 4.950 6.930 N ARRB1 n/a
4 TRCN0000005159 GCCAGTAGATACCAATCTCAT pLKO.1 1164 CDS 100% 4.950 6.930 N ARRB1 n/a
5 TRCN0000230147 TCTGGATAAGGAGATCTATTA pLKO_005 660 CDS 100% 13.200 9.240 N ARRB1 n/a
6 TRCN0000219075 ACACAAATGATGACGACATTG pLKO_005 1193 CDS 100% 10.800 7.560 N ARRB1 n/a
7 TRCN0000230149 GAACTGCCCTTCACCCTAATG pLKO_005 1090 CDS 100% 10.800 7.560 N ARRB1 n/a
8 TRCN0000005162 GAGATCTATTACCATGGAGAA pLKO.1 670 CDS 100% 4.050 2.835 N ARRB1 n/a
9 TRCN0000005163 GCTCACCGTCTACCTGGGAAA pLKO.1 105 CDS 100% 1.350 0.945 N ARRB1 n/a
10 TRCN0000005161 CACCTTTGAGATCCCTCCAAA pLKO.1 399 CDS 100% 4.950 2.970 N ARRB1 n/a
11 TRCN0000075646 GACATTGTATTTGAGGACTTT pLKO.1 1207 CDS 100% 4.950 2.970 N Arrb1 n/a
12 TRCN0000327472 GACATTGTATTTGAGGACTTT pLKO_005 1207 CDS 100% 4.950 2.970 N Arrb1 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6254 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004041.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00106 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00106 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471594 GGTGCGTGGTTTCTTTATATCATA pLX_317 29.6% 100% 100% V5 n/a
Download CSV