Transcript: Human NM_004085.4

Homo sapiens translocase of inner mitochondrial membrane 8A (TIMM8A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TIMM8A (1678)
Length:
1210
CDS:
79..372

Additional Resources:

NCBI RefSeq record:
NM_004085.4
NBCI Gene record:
TIMM8A (1678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004085.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063981 GCAGCATTTCATCGAGGTAGA pLKO.1 135 CDS 100% 4.050 5.670 N TIMM8A n/a
2 TRCN0000173310 GCTTCATTGATACAAGCCAGT pLKO.1 284 CDS 100% 2.160 3.024 N Timm8a1 n/a
3 TRCN0000233013 TGTGAAGCTTAAGGGTCATAT pLKO_005 530 3UTR 100% 13.200 10.560 N TIMM8A n/a
4 TRCN0000238788 ACTGCGTTGAGCGCTTCATTG pLKO_005 272 CDS 100% 10.800 7.560 N TIMM8A n/a
5 TRCN0000233011 GCACCAGATGACTGAACTTTG pLKO_005 186 CDS 100% 10.800 7.560 N TIMM8A n/a
6 TRCN0000233012 TCTGACTGATCTCAGCATTAC pLKO_005 364 CDS 100% 10.800 7.560 N TIMM8A n/a
7 TRCN0000063978 CCCAGAAATCCAAGCCAGTTT pLKO.1 329 CDS 100% 4.950 3.465 N TIMM8A n/a
8 TRCN0000063982 CTTCATTGATACAAGCCAGTT pLKO.1 285 CDS 100% 4.050 2.835 N TIMM8A n/a
9 TRCN0000175358 CTTCATTGATACAAGCCAGTT pLKO.1 285 CDS 100% 4.050 2.835 N Timm8a1 n/a
10 TRCN0000063979 GACTGAACTTTGTTGGGAGAA pLKO.1 195 CDS 100% 4.050 2.835 N TIMM8A n/a
11 TRCN0000063980 CCAGTTCATCTTGAATCGACT pLKO.1 300 CDS 100% 2.640 1.848 N TIMM8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004085.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00439 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00439 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467677 GTTGTCACGTCCACTGCCCATTAA pLX_317 100% 100% 100% V5 n/a
Download CSV