Transcript: Human NM_004287.4

Homo sapiens golgi SNAP receptor complex member 2 (GOSR2), transcript variant A, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GOSR2 (9570)
Length:
3988
CDS:
77..715

Additional Resources:

NCBI RefSeq record:
NM_004287.4
NBCI Gene record:
GOSR2 (9570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230164 ACTTCGGGTTGACCAGTTAAA pLKO_005 277 CDS 100% 13.200 18.480 N GOSR2 n/a
2 TRCN0000382096 ACGAATCACTGCAGTTTAACT pLKO_005 438 CDS 100% 5.625 7.875 N GOSR2 n/a
3 TRCN0000381247 CGTCTAGAACGTCTGGAGATT pLKO_005 215 CDS 100% 4.950 6.930 N GOSR2 n/a
4 TRCN0000381502 CACCACTAACGACTCTGACAC pLKO_005 403 CDS 100% 4.050 5.670 N GOSR2 n/a
5 TRCN0000380197 GAAAGTTCACAACGGCATGGA pLKO_005 469 CDS 100% 2.640 3.696 N GOSR2 n/a
6 TRCN0000060490 GTACTTTATGATAGGTGGGAT pLKO.1 646 CDS 100% 2.640 3.696 N GOSR2 n/a
7 TRCN0000381249 ACCAGTTAAAGTATGATGTCC pLKO_005 288 CDS 100% 2.640 2.112 N GOSR2 n/a
8 TRCN0000380638 GGAGTGATTGTGGTCTAATTT pLKO_005 842 3UTR 100% 15.000 10.500 N GOSR2 n/a
9 TRCN0000230166 TGTACTAATACCAGGTATATT pLKO_005 1761 3UTR 100% 15.000 10.500 N GOSR2 n/a
10 TRCN0000230165 CTTTCCAGGACAAGTACTTTA pLKO_005 633 CDS 100% 13.200 9.240 N GOSR2 n/a
11 TRCN0000230163 GCAAGCATAGACCAGATATTC pLKO_005 191 CDS 100% 13.200 9.240 N GOSR2 n/a
12 TRCN0000060492 GTCTAGAACGTCTGGAGATTT pLKO.1 216 CDS 100% 13.200 9.240 N GOSR2 n/a
13 TRCN0000380268 ACAAGCAGTCTGTGCACATAG pLKO_005 153 CDS 100% 10.800 7.560 N GOSR2 n/a
14 TRCN0000218114 AGAAGAAGATCCTTGACATTG pLKO_005 561 CDS 100% 10.800 7.560 N GOSR2 n/a
15 TRCN0000380516 ACGAAATCCAAGCAAGCATAG pLKO_005 180 CDS 100% 6.000 4.200 N GOSR2 n/a
16 TRCN0000380925 ACCATACCAATGGACGAATCA pLKO_005 425 CDS 100% 4.950 3.465 N GOSR2 n/a
17 TRCN0000060489 CAGAAGAAGATCCTTGACATT pLKO.1 560 CDS 100% 4.950 3.465 N GOSR2 n/a
18 TRCN0000060488 CCACCATACCAATGGACGAAT pLKO.1 423 CDS 100% 4.950 3.465 N GOSR2 n/a
19 TRCN0000381851 CCAGATATTCAGCCGTCTAGA pLKO_005 202 CDS 100% 4.950 3.465 N GOSR2 n/a
20 TRCN0000115095 TCAGAAGAAGATCCTTGACAT pLKO.1 559 CDS 100% 4.950 3.465 N Gosr2 n/a
21 TRCN0000320331 TCAGAAGAAGATCCTTGACAT pLKO_005 559 CDS 100% 4.950 3.465 N Gosr2 n/a
22 TRCN0000380781 AGACTGCGCTCAGAAACTTCC pLKO_005 318 CDS 100% 4.050 2.835 N GOSR2 n/a
23 TRCN0000381686 AGCGAGAAGAGCTTCTGTCTC pLKO_005 375 CDS 100% 4.050 2.835 N GOSR2 n/a
24 TRCN0000381084 CAACACAGTGATGCGGCTCAT pLKO_005 601 CDS 100% 4.050 2.835 N GOSR2 n/a
25 TRCN0000060491 CCAGAAAGTTCACAACGGCAT pLKO.1 466 CDS 100% 2.160 1.512 N GOSR2 n/a
26 TRCN0000382007 TGTGGTCATGTTCCTCGTGGT pLKO_005 679 CDS 100% 2.160 1.512 N GOSR2 n/a
27 TRCN0000381160 ACTCTGACACCACCATACCAA pLKO_005 414 CDS 100% 3.000 1.800 N GOSR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02200 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02200 pLX_304 0% 100% 100% V5 (not translated due to frame shift) n/a
3 TRCN0000474841 AGGTGTTCTGTGTGTATCATATAT pLX_317 68.7% 100% 100% V5 (not translated due to frame shift) n/a
Download CSV