Transcript: Human NM_004441.5

Homo sapiens EPH receptor B1 (EPHB1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
EPHB1 (2047)
Length:
4674
CDS:
373..3327

Additional Resources:

NCBI RefSeq record:
NM_004441.5
NBCI Gene record:
EPHB1 (2047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148060 AGGATCCTGGGACATTAGGG pXPR_003 AGG 299 10% 3 0.8225 EPHB1 EPHB1 77534
2 BRDN0001145210 GCTGGCTACGGCAAGTTCAG pXPR_003 TGG 1550 52% 7 0.3885 EPHB1 EPHB1 77532
3 BRDN0001144723 TCGGACCGGTTATTACCGAG pXPR_003 CGG 925 31% 4 0.3037 EPHB1 EPHB1 77533
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004441.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378232 ACTATGAGATCCGGTACTATG pLKO_005 1769 CDS 100% 10.800 15.120 N EPHB1 n/a
2 TRCN0000000818 GCCTCTTACTCGGAATGGTTT pLKO.1 870 CDS 100% 4.950 6.930 N EPHB1 n/a
3 TRCN0000355606 CACCTGTCGGACCGGTTATTA pLKO_005 1275 CDS 100% 15.000 12.000 N EPHB1 n/a
4 TRCN0000355608 CTGCGATGGAAGAAACGTTAA pLKO_005 419 CDS 100% 10.800 8.640 N EPHB1 n/a
5 TRCN0000000819 GCTGCGATGGAAGAAACGTTA pLKO.1 418 CDS 100% 4.950 3.960 N EPHB1 n/a
6 TRCN0000195710 CCTGAGAATAGGCATCACCTT pLKO.1 3225 CDS 100% 2.640 2.112 N EPHB1 n/a
7 TRCN0000197015 GACTCTGACTGACGATGATTA pLKO.1 1944 CDS 100% 13.200 9.240 N EPHB1 n/a
8 TRCN0000355550 GTAGCAGGAAACGGGCTTATA pLKO_005 2060 CDS 100% 13.200 9.240 N EPHB1 n/a
9 TRCN0000000821 CCTGGCTGAGATGAATTATGT pLKO.1 2574 CDS 100% 5.625 3.938 N EPHB1 n/a
10 TRCN0000000820 GACTATGAGATCCGGTACTAT pLKO.1 1768 CDS 100% 5.625 3.938 N EPHB1 n/a
11 TRCN0000196959 GCAAGTTCAGTGGCAAGATGT pLKO.1 1916 CDS 100% 4.950 3.465 N EPHB1 n/a
12 TRCN0000000817 CACTCGTTTCCCTTTGCTCAT pLKO.1 3781 3UTR 100% 4.050 2.835 N EPHB1 n/a
13 TRCN0000362367 CCATCGCCTACCGCAAGTTTA pLKO_005 2756 CDS 100% 13.200 9.240 N Ephb1 n/a
14 TRCN0000023501 CCAGGCAAGAGGGAAATCTAT pLKO.1 2293 CDS 100% 5.625 3.938 N Ephb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004441.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14628 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14628 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472498 CTTTCTAGATTTTGCCGGTGTAGC pLX_317 15.7% 100% 100% V5 n/a
4 TRCN0000489667 GTATAACCCGCCAGGCTTGTTATG pLX_317 8.7% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000492008 CTTATACTATTATCACAAAACACA pLX_317 29.2% 40% 40% V5 (not translated due to prior stop codon) 1_1770del n/a
Download CSV