Transcript: Human NM_004672.5

Homo sapiens mitogen-activated protein kinase kinase kinase 6 (MAP3K6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
MAP3K6 (9064)
Length:
4438
CDS:
365..4231

Additional Resources:

NCBI RefSeq record:
NM_004672.5
NBCI Gene record:
MAP3K6 (9064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004672.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002346 AGCGTATTAAACAGAACACTT pLKO.1 4413 3UTR 100% 4.950 6.930 N MAP3K6 n/a
2 TRCN0000002345 CGTGGAGAAGATGCAGTATTA pLKO.1 1657 CDS 100% 13.200 9.240 N MAP3K6 n/a
3 TRCN0000352611 CGTGGAGAAGATGCAGTATTA pLKO_005 1657 CDS 100% 13.200 9.240 N MAP3K6 n/a
4 TRCN0000197175 GCTTCAGCATGACCAACAATG pLKO.1 777 CDS 100% 10.800 7.560 N MAP3K6 n/a
5 TRCN0000196920 GAGCTGAATGAGGGCATCATA pLKO.1 4232 CDS 100% 5.625 3.938 N MAP3K6 n/a
6 TRCN0000002343 GTTGGAGTTTGATTATGAGTA pLKO.1 2278 CDS 100% 4.950 3.465 N MAP3K6 n/a
7 TRCN0000352677 GTTGGAGTTTGATTATGAGTA pLKO_005 2278 CDS 100% 4.950 3.465 N MAP3K6 n/a
8 TRCN0000199055 CAAGCCTTTCTCCTCCGAACT pLKO.1 3002 CDS 100% 4.050 2.835 N MAP3K6 n/a
9 TRCN0000352612 CAAGCCTTTCTCCTCCGAACT pLKO_005 3002 CDS 100% 4.050 2.835 N MAP3K6 n/a
10 TRCN0000002344 CATGTTCTTCAGCTCGGGTTT pLKO.1 1450 CDS 100% 4.050 2.835 N MAP3K6 n/a
11 TRCN0000197244 GATGAATGGAGAGGACAAAGG pLKO.1 4274 3UTR 100% 4.050 2.835 N MAP3K6 n/a
12 TRCN0000342400 GATGAATGGAGAGGACAAAGG pLKO_005 4274 3UTR 100% 4.050 2.835 N MAP3K6 n/a
13 TRCN0000002342 CAACCATTCAAGACAGCCTGT pLKO.1 1901 CDS 100% 2.160 1.512 N MAP3K6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004672.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11332 pDONR223 100% 61.4% 61.1% None (many diffs) n/a
2 ccsbBroad304_11332 pLX_304 0% 61.4% 61.1% V5 (many diffs) n/a
3 TRCN0000481050 TGATCAGTTTTTGCCATGAGCGTT pLX_317 11.9% 61.4% 61.1% V5 (many diffs) n/a
4 ccsbBroadEn_14926 pDONR223 0% 61.4% 61.1% None (many diffs) n/a
5 ccsbBroad304_14926 pLX_304 0% 61.4% 61.1% V5 (many diffs) n/a
6 TRCN0000465376 CGCAATTACCGCCGTCAACACTGT pLX_317 11.6% 61.4% 61.1% V5 (many diffs) n/a
Download CSV