Transcript: Human NM_004740.3

Homo sapiens TGFB1-induced anti-apoptotic factor 1 (TIAF1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TIAF1 (9220)
Length:
2110
CDS:
1411..1758

Additional Resources:

NCBI RefSeq record:
NM_004740.3
NBCI Gene record:
TIAF1 (9220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440210 TTCTCTCCTGCAATTGGTTTG pLKO_005 2004 3UTR 100% 6.000 3.000 Y TIAF1 n/a
2 TRCN0000107203 CGGGTCCAGGTTCTTAAGAAT pLKO.1 1483 CDS 100% 5.625 2.813 Y TIAF1 n/a
3 TRCN0000107201 CCTCTTTGTCTCAGCGTGTTA pLKO.1 1604 CDS 100% 4.950 2.475 Y TIAF1 n/a
4 TRCN0000107202 GCAATGACCTATTTAAGGTAA pLKO.1 1628 CDS 100% 4.950 2.475 Y TIAF1 n/a
5 TRCN0000442556 TGAGCAAGCCTACGCAGACAA pLKO_005 1542 CDS 100% 4.950 2.475 Y TIAF1 n/a
6 TRCN0000107204 CCCATTCCAACTACAGCAGTT pLKO.1 1650 CDS 100% 4.050 2.025 Y TIAF1 n/a
7 TRCN0000107200 CGGTGCTCATTAGACATGAGT pLKO.1 1798 3UTR 100% 0.300 0.150 Y TIAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02112 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02112 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480947 GTATTAGACACCTTGAGACTCTGA pLX_317 100% 100% 100% V5 n/a
Download CSV