Transcript: Human NM_004775.4

Homo sapiens beta-1,4-galactosyltransferase 6 (B4GALT6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
B4GALT6 (9331)
Length:
6046
CDS:
320..1468

Additional Resources:

NCBI RefSeq record:
NM_004775.4
NBCI Gene record:
B4GALT6 (9331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415820 ATGTAATCGGTTATACCTTTA pLKO_005 1868 3UTR 100% 10.800 15.120 N B4GALT6 n/a
2 TRCN0000035322 CCAGAGTTAGCTCCAATCGAA pLKO.1 1439 CDS 100% 3.000 4.200 N B4GALT6 n/a
3 TRCN0000035320 CGCCAACACATATCTCTTTAT pLKO.1 433 CDS 100% 13.200 17.160 N B4GALT6 n/a
4 TRCN0000436046 ATCGATGGACTGAACAATTTA pLKO_005 1358 CDS 100% 15.000 10.500 N B4GALT6 n/a
5 TRCN0000416274 GACCACAATGCTGGATCATAA pLKO_005 1494 3UTR 100% 13.200 9.240 N B4GALT6 n/a
6 TRCN0000035323 GAGTTCACTATGCTGGATATA pLKO.1 1218 CDS 100% 13.200 9.240 N B4GALT6 n/a
7 TRCN0000425065 TACTGGTTGATAGGTTGTATA pLKO_005 1395 CDS 100% 13.200 9.240 N B4GALT6 n/a
8 TRCN0000035321 CGCCATGAACATCTTCCAATT pLKO.1 818 CDS 100% 10.800 7.560 N B4GALT6 n/a
9 TRCN0000035319 GCTGCCTTATATGCGAGGATT pLKO.1 652 CDS 100% 4.950 3.465 N B4GALT6 n/a
10 TRCN0000077101 CGATGGACTGAACAATTTATT pLKO.1 1360 CDS 100% 15.000 10.500 N B4galt6 n/a
11 TRCN0000334278 CGATGGACTGAACAATTTATT pLKO_005 1360 CDS 100% 15.000 10.500 N B4galt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11358 pDONR223 100% 89.7% 89.7% None 470_586del n/a
2 ccsbBroad304_11358 pLX_304 0% 89.7% 89.7% V5 470_586del n/a
3 TRCN0000472131 GCACTTCGATGTTCCGATGCACAA pLX_317 44.1% 89.7% 89.7% V5 470_586del n/a
Download CSV