Transcript: Human NM_004776.4

Homo sapiens beta-1,4-galactosyltransferase 5 (B4GALT5), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
B4GALT5 (9334)
Length:
4722
CDS:
189..1355

Additional Resources:

NCBI RefSeq record:
NM_004776.4
NBCI Gene record:
B4GALT5 (9334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004776.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035359 CGGAAAGTGATCGCAACTATT pLKO.1 904 CDS 100% 13.200 18.480 N B4GALT5 n/a
2 TRCN0000421542 GTGGAAGGTGGCGATCCTTAT pLKO_005 671 CDS 100% 10.800 15.120 N B4GALT5 n/a
3 TRCN0000018785 CATAGTGAACACCTACCTCTT pLKO.1 299 CDS 100% 4.050 5.670 N B4galt5 n/a
4 TRCN0000432914 TGGACAGATGCCGAGGCATTT pLKO_005 932 CDS 100% 10.800 7.560 N B4GALT5 n/a
5 TRCN0000035363 CCTCAACAACCTGAACTACTT pLKO.1 1253 CDS 100% 4.950 3.465 N B4GALT5 n/a
6 TRCN0000035360 GCAGTGTAAATGACTCAGATT pLKO.1 421 CDS 100% 4.950 3.465 N B4GALT5 n/a
7 TRCN0000035361 CCAACCCTTTAATCGAGCCAT pLKO.1 803 CDS 100% 2.640 1.848 N B4GALT5 n/a
8 TRCN0000035362 GTGGCTTAACAGTGGAACAAT pLKO.1 1015 CDS 100% 5.625 3.375 N B4GALT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004776.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02142 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02142 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475824 TCTAGGGCTACTAGATCGGGCCGG pLX_317 30.2% 100% 100% V5 n/a
Download CSV