Transcript: Human NM_004805.4

Homo sapiens RNA polymerase II subunit D (POLR2D), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
POLR2D (5433)
Length:
5038
CDS:
56..484

Additional Resources:

NCBI RefSeq record:
NM_004805.4
NBCI Gene record:
POLR2D (5433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021364 GCCCGTTTCAGTCGTTTCAAA pLKO.1 260 CDS 100% 5.625 7.875 N POLR2D n/a
2 TRCN0000278468 GCCCGTTTCAGTCGTTTCAAA pLKO_005 260 CDS 100% 5.625 7.875 N POLR2D n/a
3 TRCN0000021365 CGTAGCTTGCTACTCCAGAAA pLKO.1 305 CDS 100% 4.950 3.960 N POLR2D n/a
4 TRCN0000297471 CGTAGCTTGCTACTCCAGAAA pLKO_005 305 CDS 100% 4.950 3.960 N POLR2D n/a
5 TRCN0000021366 GCAGCAGATTCTTGATGATAT pLKO.1 436 CDS 100% 13.200 9.240 N POLR2D n/a
6 TRCN0000021367 GCTCATCTTTCCTAAAGAGTT pLKO.1 112 CDS 100% 4.950 3.465 N POLR2D n/a
7 TRCN0000278470 GCTCATCTTTCCTAAAGAGTT pLKO_005 112 CDS 100% 4.950 3.465 N POLR2D n/a
8 TRCN0000021368 GCTCTCAGAAGTCTTCATGAA pLKO.1 223 CDS 100% 4.950 3.465 N POLR2D n/a
9 TRCN0000278467 GCTCTCAGAAGTCTTCATGAA pLKO_005 223 CDS 100% 4.950 3.465 N POLR2D n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3657 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3657 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3101 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2576 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3655 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3655 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3655 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2576 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01238 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01238 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465902 ACATAGTAGAATTAAACCTCGTAC pLX_317 86.5% 100% 100% V5 n/a
Download CSV