Transcript: Human NM_004863.3

Homo sapiens serine palmitoyltransferase long chain base subunit 2 (SPTLC2), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SPTLC2 (9517)
Length:
8164
CDS:
189..1877

Additional Resources:

NCBI RefSeq record:
NM_004863.3
NBCI Gene record:
SPTLC2 (9517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294244 TATAGCATGGAGGGATCTATT pLKO_005 1140 CDS 100% 13.200 18.480 N SPTLC2 n/a
2 TRCN0000034972 CTTCGAGATTTCTTGAGGTAT pLKO.1 447 CDS 100% 4.950 6.930 N SPTLC2 n/a
3 TRCN0000034969 GCAAGGTTCTTAGGAGTAGAA pLKO.1 858 CDS 100% 4.950 3.960 N SPTLC2 n/a
4 TRCN0000294245 CCAACCTTGGAATCCTTATTT pLKO_005 2351 3UTR 100% 15.000 10.500 N SPTLC2 n/a
5 TRCN0000294246 TGGTGCTTCTGGAGGATATAT pLKO_005 1331 CDS 100% 15.000 10.500 N SPTLC2 n/a
6 TRCN0000034971 GCTCATACCAAAGAAATACTT pLKO.1 1731 CDS 100% 5.625 3.938 N SPTLC2 n/a
7 TRCN0000286903 GCTCATACCAAAGAAATACTT pLKO_005 1731 CDS 100% 5.625 3.938 N SPTLC2 n/a
8 TRCN0000034973 CCTGAAAGAGATGGGCTTCAT pLKO.1 1544 CDS 100% 4.950 3.465 N SPTLC2 n/a
9 TRCN0000286904 CCTGAAAGAGATGGGCTTCAT pLKO_005 1544 CDS 100% 4.950 3.465 N SPTLC2 n/a
10 TRCN0000034970 GCAACCATTAGAATCTTCAAA pLKO.1 1011 CDS 100% 5.625 3.375 N SPTLC2 n/a
11 TRCN0000006768 CGAAACCTCATCTCTACTAAA pLKO.1 6632 3UTR 100% 13.200 6.600 Y F2RL1 n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3575 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07436 pDONR223 100% 99.9% 100% None 786T>C n/a
2 ccsbBroad304_07436 pLX_304 0% 99.9% 100% V5 786T>C n/a
3 TRCN0000477683 CCCGCGACTCTGGTAGTAACTTAG pLX_317 16.7% 99.9% 100% V5 786T>C n/a
Download CSV