Transcript: Human NM_004939.3

Homo sapiens DEAD-box helicase 1 (DDX1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
DDX1 (1653)
Length:
2484
CDS:
67..2289

Additional Resources:

NCBI RefSeq record:
NM_004939.3
NBCI Gene record:
DDX1 (1653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050500 CCGGGCAATCAAGGAACATAA pLKO.1 1560 CDS 100% 13.200 18.480 N DDX1 n/a
2 TRCN0000290659 CCGGGCAATCAAGGAACATAA pLKO_005 1560 CDS 100% 13.200 18.480 N DDX1 n/a
3 TRCN0000050501 GCATGGGTGTAGAGCTACTAA pLKO.1 423 CDS 100% 5.625 7.875 N DDX1 n/a
4 TRCN0000290661 GCATGGGTGTAGAGCTACTAA pLKO_005 423 CDS 100% 5.625 7.875 N DDX1 n/a
5 TRCN0000050498 CCAGGCTGAATCTATCCCATT pLKO.1 150 CDS 100% 4.050 5.670 N DDX1 n/a
6 TRCN0000290660 CCAGGCTGAATCTATCCCATT pLKO_005 150 CDS 100% 4.050 5.670 N DDX1 n/a
7 TRCN0000050499 CCGGATGGTTACATTGTCAAA pLKO.1 850 CDS 100% 4.950 3.960 N DDX1 n/a
8 TRCN0000290658 CCGGATGGTTACATTGTCAAA pLKO_005 850 CDS 100% 4.950 3.960 N DDX1 n/a
9 TRCN0000305216 GATGTGGTCTGAAGCTATTAA pLKO_005 1515 CDS 100% 15.000 10.500 N Ddx1 n/a
10 TRCN0000050502 CCAGTTATCCAGATAGTTTAT pLKO.1 241 CDS 100% 13.200 9.240 N DDX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06091 pDONR223 100% 99.9% 100% None 912C>T n/a
2 ccsbBroad304_06091 pLX_304 0% 99.9% 100% V5 912C>T n/a
3 TRCN0000472468 AAGTGACTTATGCTACTACCCCAA pLX_317 21.8% 99.9% 100% V5 912C>T n/a
4 ccsbBroadEn_10772 pDONR223 100% 94.1% 94.1% None 1_129del;912C>T n/a
Download CSV