Transcript: Human NM_005034.4

Homo sapiens RNA polymerase II subunit K (POLR2K), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLR2K (5440)
Length:
947
CDS:
84..260

Additional Resources:

NCBI RefSeq record:
NM_005034.4
NBCI Gene record:
POLR2K (5440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343392 ACCCAGAAGGACGTTCAACCT pLKO_005 90 CDS 100% 2.640 3.696 N POLR2K n/a
2 TRCN0000343432 TTTGATGCTCGATGAATGCTG pLKO_005 246 CDS 100% 2.640 3.696 N POLR2K n/a
3 TRCN0000021883 AGCAGCAACCAATGATATATA pLKO.1 115 CDS 100% 15.000 12.000 N POLR2K n/a
4 TRCN0000343434 GCAGCAACCAATGATATATAT pLKO_005 116 CDS 100% 15.000 10.500 N POLR2K n/a
5 TRCN0000343391 TTGTACAGTACTCACCTATTT pLKO_005 588 3UTR 100% 13.200 9.240 N POLR2K n/a
6 TRCN0000021880 CAGAGAATGTGGATACAGAAT pLKO.1 191 CDS 100% 4.950 3.465 N POLR2K n/a
7 TRCN0000021882 CAGATGCAGAGAATGTGGATA pLKO.1 185 CDS 100% 4.950 3.465 N POLR2K n/a
8 TRCN0000352914 CAGATGCAGAGAATGTGGATA pLKO_005 185 CDS 100% 4.950 3.465 N POLR2K n/a
9 TRCN0000111412 GCAGAGAATGTGGATACAGAA pLKO.1 190 CDS 100% 4.950 3.465 N Polr2k n/a
10 TRCN0000332511 GCAGAGAATGTGGATACAGAA pLKO_005 190 CDS 100% 4.950 3.465 N Polr2k n/a
11 TRCN0000021879 GTGGAGAGTGTCACACAGAAA pLKO.1 139 CDS 100% 4.950 3.465 N POLR2K n/a
12 TRCN0000021881 CCAATGATATATATCTGTGGA pLKO.1 123 CDS 100% 2.640 1.848 N POLR2K n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13922 pDONR223 100% 99.4% 98.2% None 173G>C n/a
2 ccsbBroad304_13922 pLX_304 0% 99.4% 98.2% V5 173G>C n/a
3 TRCN0000472343 GATTGGCTTTTCCGTATGTTGTGT pLX_317 100% 99.4% 98.2% V5 173G>C n/a
Download CSV