Transcript: Human NM_005039.3

Homo sapiens proline rich protein BstNI subfamily 1 (gene/pseudogene) (PRB1), transcript variant 1, coding, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
PRB1 (5542)
Length:
1173
CDS:
38..1033

Additional Resources:

NCBI RefSeq record:
NM_005039.3
NBCI Gene record:
PRB1 (5542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005039.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078008 CCCTCCCTAATAGCAGGAAAT pLKO.1 122 CDS 100% 10.800 5.400 Y PRB1 n/a
2 TRCN0000183583 GAATAAGAAGATGAGAGTGAT pLKO.1 1072 3UTR 100% 4.950 2.475 Y PRB2 n/a
3 TRCN0000147897 GATTCAATGACAGGAAGTGAA pLKO.1 1054 3UTR 100% 4.950 2.475 Y PRB2 n/a
4 TRCN0000078009 GCTCAGAACTTAAATGAAGAT pLKO.1 83 CDS 100% 4.950 2.475 Y PRB1 n/a
5 TRCN0000078012 AGGAAGAATCTCCCTCCCTAA pLKO.1 111 CDS 100% 4.050 2.025 Y PRB1 n/a
6 TRCN0000373239 AGGAGGCAACAAACCTCAAGG pLKO_005 226 CDS 100% 4.050 2.025 Y PRB3 n/a
7 TRCN0000373238 ATGAAGATGTCAGCCAGGAAG pLKO_005 96 CDS 100% 4.050 2.025 Y PRB3 n/a
8 TRCN0000078010 CAAGAAGGCAACAATCCTCAA pLKO.1 896 CDS 100% 4.050 2.025 Y PRB1 n/a
9 TRCN0000078011 CAAGGAGGCAACAAACCTCAA pLKO.1 224 CDS 100% 4.050 2.025 Y PRB1 n/a
10 TRCN0000021927 TCTAGGATTCAATGACAGGAA pLKO.1 1049 3UTR 100% 2.640 1.320 Y PRB4 n/a
11 TRCN0000146707 CTTAAATGAAGATGTCAGCCA pLKO.1 91 CDS 100% 0.660 0.330 Y PRB2 n/a
12 TRCN0000021924 CAGGAAGTGAATAAGAAGATA pLKO.1 1064 3UTR 100% 5.625 2.813 Y PRB4 n/a
13 TRCN0000154500 GAAGATGTCAGCCAGGAAGAT pLKO.1 98 CDS 100% 4.950 2.475 Y PRH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005039.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06764 pDONR223 100% 77.9% 68.6% None (many diffs) n/a
2 ccsbBroad304_06764 pLX_304 0% 77.9% 68.6% V5 (many diffs) n/a
3 TRCN0000469220 CAAGGACAGTGCATGGTCCCCGAC pLX_317 16.1% 77.9% 68.6% V5 (many diffs) n/a
4 TRCN0000465570 AAGTGGGAGAGTAAGTGCCTGGTC pLX_317 83.2% 24.9% 22.5% V5 (many diffs) n/a
5 ccsbBroadEn_06763 pDONR223 100% 59.5% 59.2% None (many diffs) n/a
6 ccsbBroad304_06763 pLX_304 0% 59.5% 59.2% V5 (many diffs) n/a
Download CSV