Transcript: Human NM_005161.4

Homo sapiens apelin receptor (APLNR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
APLNR (187)
Length:
3905
CDS:
450..1592

Additional Resources:

NCBI RefSeq record:
NM_005161.4
NBCI Gene record:
APLNR (187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356634 TTAGATCTGCAATCGTCTTTC pLKO_005 1934 3UTR 100% 10.800 15.120 N APLNR n/a
2 TRCN0000008099 CGCTCAGCTGATATCTTCATT pLKO.1 633 CDS 100% 5.625 7.875 N APLNR n/a
3 TRCN0000356636 CCTGAGTCTGGACGCAGTAAA pLKO_005 1889 3UTR 100% 13.200 9.240 N APLNR n/a
4 TRCN0000008100 CTACCTCATCTTCGTCAACAT pLKO.1 767 CDS 100% 4.950 3.465 N APLNR n/a
5 TRCN0000008098 GCTGACCTGTTACTTCTTCAT pLKO.1 1100 CDS 100% 4.950 3.465 N APLNR n/a
6 TRCN0000008101 TGGAGAACAGATGCACGAGAA pLKO.1 1532 CDS 100% 4.050 2.835 N APLNR n/a
7 TRCN0000356635 GAGAACAGATGCACGAGAAAT pLKO_005 1534 CDS 100% 13.200 7.920 N APLNR n/a
8 TRCN0000008097 GCTTCTAGAAGGGAAGAAATT pLKO.1 3651 3UTR 100% 13.200 7.920 N APLNR n/a
9 TRCN0000221264 CCTGCCATCTACATGTTGGTT pLKO.1 543 CDS 100% 3.000 2.100 N Aplnr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00040 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00040 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467691 CGATTAGGCTTAGGGCTGCGAGTT pLX_317 9.5% 100% 100% V5 n/a
4 TRCN0000491419 TATCAGGTTCTGCCAGGCCGGAGC pLX_317 25.4% 100% 100% V5 n/a
5 TRCN0000487737 ATTGGGATACTGGTGTTTCGATTA pLX_317 23.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV