Transcript: Human NM_005293.3

Homo sapiens G protein-coupled receptor 20 (GPR20), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GPR20 (2843)
Length:
1564
CDS:
111..1187

Additional Resources:

NCBI RefSeq record:
NM_005293.3
NBCI Gene record:
GPR20 (2843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357205 CGGTTCCATCTCGATTGATTG pLKO_005 1271 3UTR 100% 10.800 15.120 N GPR20 n/a
2 TRCN0000357135 GTGACAACAGTGCGGACCAAT pLKO_005 168 CDS 100% 4.950 6.930 N GPR20 n/a
3 TRCN0000008841 CGGTTACTTCCTCAACATGCA pLKO.1 494 CDS 100% 2.640 3.696 N GPR20 n/a
4 TRCN0000367794 CCACTGTGCTGTGGTTGATTA pLKO_005 1330 3UTR 100% 13.200 9.240 N GPR20 n/a
5 TRCN0000008842 TGCTGGTCATCAGCGTGTTTA pLKO.1 736 CDS 100% 13.200 9.240 N GPR20 n/a
6 TRCN0000357134 TCACGGTGCTCATCATCTTTC pLKO_005 841 CDS 100% 10.800 7.560 N GPR20 n/a
7 TRCN0000008840 CTCACGGTGCTCATCATCTTT pLKO.1 840 CDS 100% 5.625 3.938 N GPR20 n/a
8 TRCN0000357133 AGACACCCTCAGTCATCTACA pLKO_005 364 CDS 100% 4.950 3.465 N GPR20 n/a
9 TRCN0000008843 CCTCAGTCATCTACACCATCA pLKO.1 370 CDS 100% 4.050 2.835 N GPR20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06312 pDONR223 100% 99.7% 99.7% None 465C>T;624C>T;689A>G n/a
2 ccsbBroad304_06312 pLX_304 0% 99.7% 99.7% V5 465C>T;624C>T;689A>G n/a
3 TRCN0000478486 TCATTGCTGGCTATCCGTTGTCGC pLX_317 32.9% 99.7% 99.7% V5 465C>T;624C>T;689A>G n/a
4 TRCN0000488074 TGTCAGAGCTTCTATTACTCACCA pLX_317 29% 99.7% 99.7% V5 (not translated due to prior stop codon) 465C>T;624C>T;689A>G n/a
5 TRCN0000491310 TCCTCGGTTTCTGACTGATCCCCC pLX_317 17.8% 99.6% 99.4% V5 (many diffs) n/a
Download CSV