Transcript: Human NM_005338.7

Homo sapiens huntingtin interacting protein 1 (HIP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HIP1 (3092)
Length:
8009
CDS:
22..3135

Additional Resources:

NCBI RefSeq record:
NM_005338.7
NBCI Gene record:
HIP1 (3092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005338.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379459 AGCCAATGAACAGCGATATAG pLKO_005 1407 CDS 100% 13.200 18.480 N HIP1 n/a
2 TRCN0000033448 GCAAGCTATTCAGGTGCTCAT pLKO.1 2514 CDS 100% 4.050 5.670 N HIP1 n/a
3 TRCN0000033445 CCTCAACCATTTCCGGCAAAT pLKO.1 2873 CDS 100% 10.800 8.640 N HIP1 n/a
4 TRCN0000310431 CCTCAACCATTTCCGGCAAAT pLKO_005 2873 CDS 100% 10.800 8.640 N HIP1 n/a
5 TRCN0000381931 ATCCAGTCCTGCTGACTATTT pLKO_005 3449 3UTR 100% 13.200 9.240 N HIP1 n/a
6 TRCN0000380623 GCCAGCACAGAGGAATCTATG pLKO_005 1837 CDS 100% 10.800 7.560 N HIP1 n/a
7 TRCN0000033447 CCTCTTCCAAACAGTATTCAA pLKO.1 612 CDS 100% 5.625 3.938 N HIP1 n/a
8 TRCN0000299589 CCTCTTCCAAACAGTATTCAA pLKO_005 612 CDS 100% 5.625 3.938 N HIP1 n/a
9 TRCN0000033444 GCCTTCAAGAATCAGAAGAAA pLKO.1 4519 3UTR 100% 5.625 3.938 N HIP1 n/a
10 TRCN0000299590 GCCTTCAAGAATCAGAAGAAA pLKO_005 4519 3UTR 100% 5.625 3.938 N HIP1 n/a
11 TRCN0000033446 CCTTCAATTTCAACAGTCAAA pLKO.1 1097 CDS 100% 4.950 3.465 N HIP1 n/a
12 TRCN0000299591 CCTTCAATTTCAACAGTCAAA pLKO_005 1097 CDS 100% 4.950 3.465 N HIP1 n/a
13 TRCN0000381275 AGTACTTCAAGCGGCTCATTC pLKO_005 860 CDS 100% 10.800 6.480 N Hip1 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5313 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5314 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005338.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06366 pDONR223 100% 99.9% 100% None 2496A>G;2790C>T n/a
2 ccsbBroad304_06366 pLX_304 0% 99.9% 100% V5 2496A>G;2790C>T n/a
3 TRCN0000470225 GGCGCGTCTAACTGGCTTTCCGAC pLX_317 15.8% 99.9% 100% V5 2496A>G;2790C>T n/a
Download CSV