Transcript: Human NM_005382.2

Homo sapiens neurofilament medium (NEFM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NEFM (4741)
Length:
3271
CDS:
34..2784

Additional Resources:

NCBI RefSeq record:
NM_005382.2
NBCI Gene record:
NEFM (4741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296384 CACTTCACACGCCATAGTAAA pLKO_005 2742 CDS 100% 13.200 18.480 N NEFM n/a
2 TRCN0000296324 GCTCGTCATTTGCGCGAATAC pLKO_005 1165 CDS 100% 10.800 15.120 N NEFM n/a
3 TRCN0000089732 AGAGTGGTTCAAATGCCGCTA pLKO.1 900 CDS 100% 2.160 3.024 N Nefm n/a
4 TRCN0000116392 CGATTTCCTAAGCTGTTGGAA pLKO.1 2998 3UTR 100% 3.000 2.400 N NEFM n/a
5 TRCN0000422455 AGCCTTAAGAAAGCTATATAT pLKO_005 3103 3UTR 100% 15.000 10.500 N Nefm n/a
6 TRCN0000116394 GAGACTAGATTTAGCACATTT pLKO.1 1258 CDS 100% 13.200 9.240 N NEFM n/a
7 TRCN0000116393 GCTACCAAATACATCACTAAA pLKO.1 2638 CDS 100% 13.200 9.240 N NEFM n/a
8 TRCN0000296383 GGGATTCAAATGCATGATATT pLKO_005 2956 3UTR 100% 13.200 9.240 N NEFM n/a
9 TRCN0000116395 AGAGACTAGATTTAGCACATT pLKO.1 1257 CDS 100% 4.950 3.465 N NEFM n/a
10 TRCN0000289782 AGAGACTAGATTTAGCACATT pLKO_005 1257 CDS 100% 4.950 3.465 N NEFM n/a
11 TRCN0000116396 GTGCTACCAAATACATCACTA pLKO.1 2636 CDS 100% 4.950 3.465 N NEFM n/a
12 TRCN0000289719 GTGCTACCAAATACATCACTA pLKO_005 2636 CDS 100% 4.950 3.465 N NEFM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06630 pDONR223 100% 99.9% 99.8% None 1315C>A n/a
2 ccsbBroad304_06630 pLX_304 0% 99.9% 99.8% V5 1315C>A n/a
3 TRCN0000481510 GTCCAGATGAACATCACGTCCCCT pLX_317 17.6% 99.9% 99.8% V5 1315C>A n/a
Download CSV