Transcript: Human NM_005390.5

Homo sapiens pyruvate dehydrogenase E1 alpha 2 subunit (PDHA2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PDHA2 (5161)
Length:
1372
CDS:
59..1225

Additional Resources:

NCBI RefSeq record:
NM_005390.5
NBCI Gene record:
PDHA2 (5161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005390.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218955 AGATAGCCGAAGCTTTCAATA pLKO_005 660 CDS 100% 13.200 18.480 N PDHA2 n/a
2 TRCN0000220876 GCATCCCGTAACTCCTCAAAT pLKO.1 128 CDS 100% 13.200 18.480 N PDHA2 n/a
3 TRCN0000230723 ATCACGTCATTACATCCTATA pLKO_005 387 CDS 100% 10.800 15.120 N PDHA2 n/a
4 TRCN0000220874 CCTCGGATCACGTCATTACAT pLKO.1 381 CDS 100% 5.625 7.875 N PDHA2 n/a
5 TRCN0000230726 CAAATCCATGGATCAAGTTTA pLKO_005 1191 CDS 100% 13.200 10.560 N PDHA2 n/a
6 TRCN0000220873 CGCATGGAATTGAAGGCAGAT pLKO.1 269 CDS 100% 4.050 3.240 N PDHA2 n/a
7 TRCN0000230725 GAAGTAAGAGGGATCCTATAA pLKO_005 984 CDS 100% 13.200 9.240 N PDHA2 n/a
8 TRCN0000230724 TCTGTGAGAATAACCTATATG pLKO_005 714 CDS 100% 13.200 9.240 N PDHA2 n/a
9 TRCN0000220877 TCTCCAAGATAGAATGGTAAA pLKO.1 1009 CDS 100% 10.800 7.560 N PDHA2 n/a
10 TRCN0000041923 CCGTTATCATGGACACAGTAT pLKO.1 913 CDS 100% 4.950 3.465 N Pdha2 n/a
11 TRCN0000220875 CATCACATCTACAGCAGTGAT pLKO.1 1148 CDS 100% 0.495 0.347 N PDHA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005390.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15520 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15520 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481360 TGCTTTGCTGAATTACAAGGGGCC pLX_317 38.9% 100% 100% V5 n/a
4 ccsbBroadEn_01163 pDONR223 100% 83.1% 85.1% None (many diffs) n/a
5 ccsbBroad304_01163 pLX_304 0% 83.1% 85.1% V5 (many diffs) n/a
6 TRCN0000474017 GATACTATTAATTACCGACAGACC pLX_317 44.5% 83.1% 85.1% V5 (many diffs) n/a
Download CSV