Transcript: Human NM_005518.4

Homo sapiens 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
HMGCS2 (3158)
Length:
2433
CDS:
62..1588

Additional Resources:

NCBI RefSeq record:
NM_005518.4
NBCI Gene record:
HMGCS2 (3158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005518.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440562 GCCGTCTATCCCAGTGGTAAT pLKO_005 653 CDS 100% 10.800 15.120 N HMGCS2 n/a
2 TRCN0000429288 GGATTCAGGCAATACTGATAT pLKO_005 511 CDS 100% 13.200 10.560 N HMGCS2 n/a
3 TRCN0000419037 CCCTTCACCCTTGACGATTTA pLKO_005 926 CDS 100% 13.200 9.240 N HMGCS2 n/a
4 TRCN0000045858 CCTGAGGAGTTCACAGAAATA pLKO.1 1430 CDS 100% 13.200 9.240 N HMGCS2 n/a
5 TRCN0000045862 GAGGGCATAGATACCACCAAT pLKO.1 533 CDS 100% 4.950 3.465 N HMGCS2 n/a
6 TRCN0000045860 CCTTCTCTTATGGCTCTGGTT pLKO.1 1287 CDS 100% 2.640 1.848 N HMGCS2 n/a
7 TRCN0000045861 GAGAAGTATAACAATGTGGAA pLKO.1 281 CDS 100% 2.640 1.848 N HMGCS2 n/a
8 TRCN0000045859 CCCTTGACGATTTACAGTATA pLKO.1 933 CDS 100% 13.200 18.480 N HMGCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005518.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00756 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00756 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475671 TGGTATTTCCTAATAACTATATAT pLX_317 8.2% 100% 100% V5 n/a
Download CSV