Transcript: Human NM_005527.4

Homo sapiens heat shock protein family A (Hsp70) member 1 like (HSPA1L), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HSPA1L (3305)
Length:
2762
CDS:
409..2334

Additional Resources:

NCBI RefSeq record:
NM_005527.4
NBCI Gene record:
HSPA1L (3305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029443 GCCATTGCCTATGGTTTAGAT pLKO.1 952 CDS 100% 5.625 7.875 N HSPA1L n/a
2 TRCN0000029440 GCCAAGATGGATAAGGCTAAA pLKO.1 1384 CDS 100% 10.800 7.560 N HSPA1L n/a
3 TRCN0000029442 CCACAATTGAAGAAGTAGATT pLKO.1 2312 CDS 100% 5.625 3.938 N HSPA1L n/a
4 TRCN0000029439 GCAAGATTAGTGAGTCTGATA pLKO.1 2093 CDS 100% 4.950 3.465 N HSPA1L n/a
5 TRCN0000029441 CCCTGAGGAAATCTCTTCGAT pLKO.1 759 CDS 100% 3.000 2.100 N HSPA1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005527.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06407 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
2 ccsbBroad304_06407 pLX_304 0% 99.7% 99.3% V5 (many diffs) n/a
3 TRCN0000467614 AGCCAACACTCATGATTCTGTCTT pLX_317 25.4% 99.7% 99.3% V5 (many diffs) n/a
4 TRCN0000492199 ACCGGCCTATTCCTTCTGTTGGGT pLX_317 20.7% 81% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_06406 pDONR223 100% 80.9% 88.1% None (many diffs) n/a
6 ccsbBroad304_06406 pLX_304 0% 80.9% 88.1% V5 (many diffs) n/a
7 TRCN0000473615 TGGGTACTTTGGGTACTGAGTGGA pLX_317 21.8% 80.9% 88.1% V5 (many diffs) n/a
Download CSV