Transcript: Human NM_005553.3

Homo sapiens keratin associated protein 5-9 (KRTAP5-9), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
KRTAP5-9 (3846)
Length:
1188
CDS:
239..748

Additional Resources:

NCBI RefSeq record:
NM_005553.3
NBCI Gene record:
KRTAP5-9 (3846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244638 CCAACAAGTGACTACCCTTGA pLKO_005 794 3UTR 100% 4.050 5.670 N KRTAP5-9 n/a
2 TRCN0000244640 ATCCCAAGACCCAGGCAATTT pLKO_005 920 3UTR 100% 13.200 9.240 N KRTAP5-9 n/a
3 TRCN0000244637 CCCTGAGGAAATGGAATGAAC pLKO_005 872 3UTR 100% 4.950 3.465 N KRTAP5-9 n/a
4 TRCN0000244636 CTCCCTGCCCATTCCCTATAA pLKO_005 895 3UTR 100% 13.200 7.920 N KRTAP5-9 n/a
5 TRCN0000244639 TGCAAGATCTGAGGCTCTAGT pLKO_005 737 CDS 100% 4.950 2.970 N KRTAP5-9 n/a
6 TRCN0000254461 TCCCAGTGCAGTTGCTGCAAG pLKO_005 470 CDS 100% 1.350 0.675 Y KRTAP5-6 n/a
7 TRCN0000254456 TCCTCAGGCTGTGGGTCATTC pLKO_005 647 CDS 100% 3.600 1.800 Y KRTAP5-11 n/a
8 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 624 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00915 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 100% 100% V5 n/a
4 ccsbBroadEn_05666 pDONR223 100% 64.1% 60.5% None (many diffs) n/a
5 ccsbBroad304_05666 pLX_304 0% 64.1% 60.5% V5 (many diffs) n/a
6 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 64.1% 60.5% V5 (many diffs) n/a
Download CSV