Transcript: Human NM_005608.3

Homo sapiens protein tyrosine phosphatase receptor type C associated protein (PTPRCAP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PTPRCAP (5790)
Length:
907
CDS:
64..684

Additional Resources:

NCBI RefSeq record:
NM_005608.3
NBCI Gene record:
PTPRCAP (5790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052773 ACAGGCATCAGGCAACCATTT pLKO.1 863 3UTR 100% 10.800 5.400 Y PTPRCAP n/a
2 TRCN0000367393 ATGAGCAGGACACAGACTATG pLKO_005 389 CDS 100% 10.800 5.400 Y PTPRCAP n/a
3 TRCN0000367437 TCCATGTCACCGCACTGTAGA pLKO_005 665 CDS 100% 4.950 2.475 Y PTPRCAP n/a
4 TRCN0000052774 TGAGCAGGACACAGACTATGA pLKO.1 390 CDS 100% 4.950 2.475 Y PTPRCAP n/a
5 TRCN0000367450 GGTCCACAGACAATGACCTTG pLKO_005 356 CDS 100% 4.050 2.025 Y PTPRCAP n/a
6 TRCN0000377213 TGAGTGACCTGCACGCCTTTG pLKO_005 593 CDS 100% 2.000 1.000 Y PTPRCAP n/a
7 TRCN0000052776 GAAGGCGAGCAGCAATGTGGA pLKO.1 448 CDS 100% 0.880 0.440 Y PTPRCAP n/a
8 TRCN0000052775 TGAGCGACAGGAGGATGAGCA pLKO.1 375 CDS 100% 0.880 0.440 Y PTPRCAP n/a
9 TRCN0000052777 CTCTGTCACCGTTGTCCTGCT pLKO.1 159 CDS 100% 0.720 0.360 Y PTPRCAP n/a
10 TRCN0000220422 GCCCTGCTGAGTGACCTGCAT pLKO.1 586 CDS 100% 0.000 0.000 Y Ptprcap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01344 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01344 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480105 TGCGAACTTACTCTATTTTTGGCA pLX_317 59.1% 100% 100% V5 n/a
Download CSV