Transcript: Human NM_005614.4

Homo sapiens Ras homolog, mTORC1 binding (RHEB), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RHEB (6009)
Length:
2046
CDS:
385..939

Additional Resources:

NCBI RefSeq record:
NM_005614.4
NBCI Gene record:
RHEB (6009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039598 CCCTCCCTTCAGATTATGTTA pLKO.1 1071 3UTR 100% 5.625 7.875 N RHEB n/a
2 TRCN0000039600 CAAGTCTTCATGCTCGGTGAT pLKO.1 915 CDS 100% 4.050 5.670 N RHEB n/a
3 TRCN0000010425 TTATGTTGGTTGGGAATAAGA pLKO.1 725 CDS 100% 5.625 3.375 N RHEB n/a
4 TRCN0000039599 CCTATTATGTTGGTTGGGAAT pLKO.1 721 CDS 100% 4.050 2.430 N RHEB n/a
5 TRCN0000009865 TATCATCTTCAACTTGTAGAC pLKO.1 544 CDS 100% 4.050 2.430 N RHEB n/a
6 TRCN0000415710 ATGGAAAGGGTGATCAGTTAT pLKO_005 757 CDS 100% 13.200 6.600 Y RHEB n/a
7 TRCN0000435736 CAAAGTTGATCACAGTAAATG pLKO_005 515 CDS 100% 13.200 6.600 Y RHEB n/a
8 TRCN0000436662 CAATTTGTTGAAGGCCAATTT pLKO_005 457 CDS 100% 13.200 6.600 Y RHEB n/a
9 TRCN0000075605 CAGACATACTCCATAGATATT pLKO.1 598 CDS 100% 13.200 6.600 Y Rheb n/a
10 TRCN0000039602 CCGGGCAAGATGAATATTCTA pLKO.1 569 CDS 100% 5.625 2.813 Y RHEB n/a
11 TRCN0000039601 CCTACGATCCAACCATAGAAA pLKO.1 485 CDS 100% 5.625 2.813 Y RHEB n/a
12 TRCN0000010424 CCTCAGACATACTCCATAGAT pLKO.1 595 CDS 100% 5.625 2.813 Y RHEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01398 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01398 pLX_304 98.4% 100% 100% V5 n/a
3 TRCN0000468386 ATTCCCATCTACATCCAGAAAAAC pLX_317 61.3% 100% 100% V5 n/a
4 ccsbBroadEn_06864 pDONR223 100% 99.8% 99.4% None 257C>T n/a
5 ccsbBroad304_06864 pLX_304 98.4% 99.8% 99.4% V5 257C>T n/a
6 TRCN0000475474 AGGTGTTTCACCGGGTTTCGAGCT pLX_317 49.6% 99.8% 99.4% V5 257C>T n/a
Download CSV