Transcript: Human NM_005631.5

Homo sapiens smoothened, frizzled class receptor (SMO), mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
SMO (6608)
Length:
3977
CDS:
520..2883

Additional Resources:

NCBI RefSeq record:
NM_005631.5
NBCI Gene record:
SMO (6608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005631.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378375 ACGTCAATGCGTGCTTCTTTG pLKO_005 1325 CDS 100% 10.800 15.120 N SMO n/a
2 TRCN0000014363 CCAACCTCTTTGCGTTTCCTT pLKO.1 3535 3UTR 100% 3.000 2.400 N SMO n/a
3 TRCN0000358090 ATCGCTACCCTGCTGTTATTC pLKO_005 1298 CDS 100% 13.200 9.240 N SMO n/a
4 TRCN0000358091 TCAACCTGTTTGCCATGTTTG pLKO_005 2078 CDS 100% 10.800 7.560 N SMO n/a
5 TRCN0000014367 CCTGACTGTGAGATCAAGAAT pLKO.1 2032 CDS 100% 5.625 3.938 N SMO n/a
6 TRCN0000014366 CATCTTTGTCATCGTGTACTA pLKO.1 1467 CDS 100% 4.950 3.465 N SMO n/a
7 TRCN0000014364 GTGGAGAAGATCAACCTGTTT pLKO.1 2068 CDS 100% 4.950 3.465 N SMO n/a
8 TRCN0000014365 CCTGATGGACACAGAACTCAT pLKO.1 2841 CDS 100% 4.950 2.970 N SMO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005631.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487980 GTCACACCAAAATTATTAAGGAAA pLX_317 10.9% 99.9% 100% V5 (not translated due to prior stop codon) 1164G>C n/a
2 TRCN0000488659 CTGGCCATTTTTGGCTGTGATGTG pLX_317 10.8% 99.9% 99.8% V5 1164G>C;2361_2362insG n/a
Download CSV