Transcript: Human NM_005651.4

Homo sapiens tryptophan 2,3-dioxygenase (TDO2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TDO2 (6999)
Length:
1700
CDS:
64..1284

Additional Resources:

NCBI RefSeq record:
NM_005651.4
NBCI Gene record:
TDO2 (6999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424054 ATCATAACTCATCAAGCTTAT pLKO_005 280 CDS 100% 10.800 15.120 N TDO2 n/a
2 TRCN0000064901 GCTATCACTACCTGCGATCAA pLKO.1 1103 CDS 100% 4.950 6.930 N TDO2 n/a
3 TRCN0000428382 GATGACCAAATGGAGATATAA pLKO_005 1023 CDS 100% 15.000 10.500 N TDO2 n/a
4 TRCN0000434265 AGTGATAGGTACAAGGTATTT pLKO_005 1129 CDS 100% 13.200 9.240 N TDO2 n/a
5 TRCN0000064900 CGAGTGTCAGTGATCCTGAAA pLKO.1 412 CDS 100% 4.950 3.465 N TDO2 n/a
6 TRCN0000064902 GCACAAGAACTGCAAAGTGAA pLKO.1 223 CDS 100% 4.950 3.465 N TDO2 n/a
7 TRCN0000064899 CGTGATAACTTCAAAGGAGAA pLKO.1 604 CDS 100% 4.050 2.835 N TDO2 n/a
8 TRCN0000412874 GAACATGCTTAAGGTTGTTTC pLKO_005 381 CDS 100% 10.800 6.480 N TDO2 n/a
9 TRCN0000064898 GCTGGAAAGAACTCCAGGTTT pLKO.1 687 CDS 100% 0.495 0.297 N TDO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01657 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01657 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473643 TGTCCCACAGGAGCATGGAAGCCC pLX_317 45.4% 100% 100% V5 n/a
Download CSV