Transcript: Human NM_005668.6

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ST8SIA4 (7903)
Length:
6321
CDS:
328..1407

Additional Resources:

NCBI RefSeq record:
NM_005668.6
NBCI Gene record:
ST8SIA4 (7903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005668.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431489 AGCGGTCAAATATCATTATTA pLKO_005 1257 CDS 100% 15.000 21.000 N ST8SIA4 n/a
2 TRCN0000433164 AGCACGTGGAGTGGGTTAATG pLKO_005 1031 CDS 100% 13.200 18.480 N ST8SIA4 n/a
3 TRCN0000413022 TATCCGTCATTGAGACTTATT pLKO_005 1090 CDS 100% 13.200 18.480 N ST8SIA4 n/a
4 TRCN0000035210 CCTCACAGAATGCCATTAGAA pLKO.1 1315 CDS 100% 5.625 7.875 N ST8SIA4 n/a
5 TRCN0000430931 AGTGCACTCATCATTAGTTAA pLKO_005 1678 3UTR 100% 13.200 9.240 N ST8SIA4 n/a
6 TRCN0000035213 CCACAAGATTCTGTGATGAAA pLKO.1 1190 CDS 100% 5.625 3.938 N ST8SIA4 n/a
7 TRCN0000035209 CCAATGAAGAATCGCAGGTTT pLKO.1 724 CDS 100% 4.950 3.465 N ST8SIA4 n/a
8 TRCN0000035211 CGGACACTAAACATTTCTCAT pLKO.1 673 CDS 100% 4.950 3.465 N ST8SIA4 n/a
9 TRCN0000035212 GCTGACCAACAAAGTTCCTAT pLKO.1 1131 CDS 100% 4.950 3.465 N ST8SIA4 n/a
10 TRCN0000093937 CCTGAAGTTTCACCAATGAAA pLKO.1 712 CDS 100% 0.563 0.394 N St8sia4 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2316 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2316 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005668.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07186 pDONR223 100% 46.7% 46.5% None 20G>A;505_1077del n/a
2 ccsbBroad304_07186 pLX_304 0% 46.7% 46.5% V5 20G>A;505_1077del n/a
3 TRCN0000470116 TCTGCCCACCCAGCGGGCCTGAGG pLX_317 3.8% 46.7% 46.5% V5 20G>A;505_1077del n/a
Download CSV