Transcript: Human NM_005767.6

Homo sapiens lysophosphatidic acid receptor 6 (LPAR6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LPAR6 (10161)
Length:
2969
CDS:
1591..2625

Additional Resources:

NCBI RefSeq record:
NM_005767.6
NBCI Gene record:
LPAR6 (10161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005767.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358036 TGTTTGTGCTTGGGTTAATAT pLKO_005 1670 CDS 100% 15.000 21.000 N LPAR6 n/a
2 TRCN0000358094 ACCCTATAGTTTACTACTTTA pLKO_005 2450 CDS 100% 13.200 18.480 N LPAR6 n/a
3 TRCN0000014066 GCATAACCTACAGACCTTAAA pLKO.1 2571 CDS 100% 13.200 18.480 N LPAR6 n/a
4 TRCN0000218733 TGTATCCACTCCATCTGATTT pLKO_005 2805 3UTR 100% 13.200 18.480 N LPAR6 n/a
5 TRCN0000218078 GACTCCTTTAAGTACACTTTG pLKO_005 1627 CDS 100% 10.800 15.120 N LPAR6 n/a
6 TRCN0000257118 TGCGTCCTCAAAGTCCGAAAT pLKO_005 1720 CDS 100% 10.800 15.120 N LPAR6 n/a
7 TRCN0000218573 TTACTTCACAACACGGAATTG pLKO_005 1815 CDS 100% 10.800 15.120 N LPAR6 n/a
8 TRCN0000014065 CTACTTTACATCGGACACAAT pLKO.1 2463 CDS 100% 4.950 6.930 N LPAR6 n/a
9 TRCN0000357965 GAAATTAACACATGGACATTT pLKO_005 2720 3UTR 100% 13.200 9.240 N LPAR6 n/a
10 TRCN0000218574 TGGCAATTGTCTACCCATTTA pLKO_005 1937 CDS 100% 13.200 9.240 N LPAR6 n/a
11 TRCN0000014067 GCATTCTGTTCTTAACCTGTA pLKO.1 1898 CDS 100% 4.050 2.835 N LPAR6 n/a
12 TRCN0000014063 GACAGAACTTTCAAGTTCCTT pLKO.1 2650 3UTR 100% 0.300 0.210 N LPAR6 n/a
13 TRCN0000014064 CCGAAATGAAACTACAACTTA pLKO.1 1734 CDS 100% 5.625 3.375 N LPAR6 n/a
14 TRCN0000164295 CAAAGATTGCTGCCTGTTCTT pLKO.1 460 5UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005767.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02336 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02336 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481476 CGGCTGACGAGCCGCAATGACCCC pLX_317 40.9% 100% 100% V5 n/a
4 TRCN0000488937 CCTCGACCCATGGTACCCCGTTTC pLX_317 30.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489415 GCGCCCGCCACACGCTCCTAATCG pLX_317 30.6% 99.9% 99.7% V5 1032_1033insG n/a
Download CSV