Transcript: Human NM_005801.4

Homo sapiens eukaryotic translation initiation factor 1 (EIF1), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
EIF1 (10209)
Length:
2338
CDS:
155..496

Additional Resources:

NCBI RefSeq record:
NM_005801.4
NBCI Gene record:
EIF1 (10209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005801.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310709 GTAACTCCTTCATGCAATAAA pLKO_005 636 3UTR 100% 15.000 21.000 N EIF1 n/a
2 TRCN0000257794 ATCGCTGATGATTACGATAAA pLKO_005 302 CDS 100% 13.200 18.480 N Eif1 n/a
3 TRCN0000310713 TAGTCTTGAAGTCCCTCATTT pLKO_005 677 3UTR 100% 13.200 18.480 N EIF1 n/a
4 TRCN0000256437 GATCGCTGATGATTACGATAA pLKO_005 301 CDS 100% 10.800 15.120 N Gm16378 n/a
5 TRCN0000369851 TTAAGTGCTTGTGGCTCACTG pLKO_005 493 CDS 100% 4.050 3.240 N EIF1 n/a
6 TRCN0000061749 ACTGTAATTGAGCATCCGGAA pLKO.1 368 CDS 100% 2.160 1.728 N EIF1 n/a
7 TRCN0000270619 ACTGAGGATTATATCCATATA pLKO_005 233 CDS 100% 13.200 9.240 N Gm6900 n/a
8 TRCN0000061748 CCGGAATATGGAGAAGTAATT pLKO.1 383 CDS 100% 13.200 9.240 N EIF1 n/a
9 TRCN0000256440 CCTGCAATGGTACTGTAATTG pLKO_005 357 CDS 100% 13.200 9.240 N Gm16378 n/a
10 TRCN0000310707 CTGAACAGTCCTCGGTGAATC pLKO_005 861 3UTR 100% 10.800 7.560 N EIF1 n/a
11 TRCN0000303471 CTTGTATAATGTAACCATTTG pLKO_005 590 3UTR 100% 10.800 7.560 N EIF1 n/a
12 TRCN0000061750 GCACTGAGGATTATATCCATA pLKO.1 231 CDS 100% 4.950 3.465 N EIF1 n/a
13 TRCN0000061751 CGTAGAGATTGGACTGGCTAA pLKO.1 445 CDS 100% 4.050 2.835 N EIF1 n/a
14 TRCN0000061752 TGGAGAAGTAATTCAGCTACA pLKO.1 391 CDS 100% 4.050 2.835 N EIF1 n/a
15 TRCN0000315700 TGGAGAAGTAATTCAGCTACA pLKO_005 391 CDS 100% 4.050 2.835 N EIF1 n/a
16 TRCN0000240338 TGCTGGCACTGAGGATTATAT pLKO_005 226 CDS 100% 15.000 9.000 N EIF1P3 n/a
17 TRCN0000247467 TGCTGGCACTGAGGATTATAT pLKO_005 226 CDS 100% 15.000 9.000 N Eif1 n/a
18 TRCN0000240339 CCCTTTGCTGATGCAAGTAAG pLKO_005 188 CDS 100% 10.800 6.480 N EIF1P3 n/a
19 TRCN0000247468 CCCTTTGCTGATGCAAGTAAG pLKO_005 188 CDS 100% 10.800 6.480 N Eif1 n/a
20 TRCN0000189810 GCTGATGCAAGTAAGGGTGAT pLKO.1 194 CDS 100% 4.050 2.430 N Eif1 n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1723 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1723 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005801.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02386 pDONR223 100% 82% 92% None (many diffs) n/a
2 ccsbBroad304_02386 pLX_304 0% 82% 92% V5 (many diffs) n/a
3 TRCN0000472609 CCAACCTAATTGTATATGATGCAA pLX_317 100% 82% 92% V5 (many diffs) n/a
Download CSV