Transcript: Human NM_005958.4

Homo sapiens melatonin receptor 1A (MTNR1A), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
MTNR1A (4543)
Length:
1289
CDS:
203..1255

Additional Resources:

NCBI RefSeq record:
NM_005958.4
NBCI Gene record:
MTNR1A (4543)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005958.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009186 CCACTGATGACCAACAATAAT pLKO.1 1211 CDS 100% 15.000 21.000 N MTNR1A n/a
2 TRCN0000357576 AGCGTCATCGGCTCCATATTC pLKO_005 530 CDS 100% 13.200 18.480 N MTNR1A n/a
3 TRCN0000368549 AGTTACTACATGGCGTATTTC pLKO_005 1040 CDS 100% 13.200 18.480 N MTNR1A n/a
4 TRCN0000009184 GCTGCCTCAATGCCATTATAT pLKO.1 1065 CDS 100% 15.000 10.500 N MTNR1A n/a
5 TRCN0000357648 TTGGTGCTGATGTCGATATTT pLKO_005 449 CDS 100% 15.000 10.500 N MTNR1A n/a
6 TRCN0000009185 GCTGATGTCGATATTTAACAA pLKO.1 454 CDS 100% 5.625 3.938 N MTNR1A n/a
7 TRCN0000011774 GCCAGTTACTACATGGCGTAT pLKO.1 1037 CDS 100% 4.050 2.835 N MTNR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005958.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01049 pDONR223 100% 100% 100% None n/a
2 TRCN0000488582 AACTTAACGGTGGATGGACTATTT pLX_317 29.1% 100% 100% V5 n/a
3 TRCN0000492315 AATGGCAGCTTGACTTCAATGCAC pLX_317 39% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV